Previous Contig 000108:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002N04Sequence572000108 (3)gb:AB025613_15163645e-35Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT005390_1638692010967 (3)gb:AF492635_18049601e-38Capsicum annuum putative anthocyanidine rhamnosyl-transferase (upa11) mRNA, comp
JMFF036G23Sequence580000108 (3)gb:AB025613_15163642e-35Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT005390_1638679010967 (3)gb:AF492635_18049601e-42Capsicum annuum putative anthocyanidine rhamnosyl-transferase (upa11) mRNA, comp
JMFF050C22Sequence579000108 (3)gb:AB025613_15163645e-36Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT005390_1638478010967 (3)gb:AF492635_18049603e-27Capsicum annuum putative anthocyanidine rhamnosyl-transferase (upa11) mRNA, comp

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050C22+ CCGGGCGGGACGGTGAAGTGTTCGGGGCTCGGGCGCAGTTTTC
JMFF036G23+ GGCGGGACGGTGAAGTGTTCGGGGCTCGGGCGCAGTTTTC
JMFF002N04+ GGTGAAGTGTTCGGGGCTCGGGCGCAGTTTTC
                      ____________________________________________________________
consensus CCGGGCGGGACGGTGAAGTGTTCGGGGCTCGGGCGCAGTTTTC
 
. : . : . : . : . : . :
JMFF050C22+ CCGATCTCAACTCCTCGGGGGATCCCAGGTACGCTAATGTTGCTGCAGTGTATACACTTA
JMFF036G23+ CCGATCTCAACTCCTCGGGGGATCCCAGGTACGCTAATGTTGCTGCAGTGTATACACTTA
JMFF002N04+ CCGATCTCAACTCCTCGGGGGATCCCAGGTACGCTAATGTTGCTGCAGTGTATACACTTA
                      ____________________________________________________________
consensus CCGATCTCAACTCCTCGGGGGATCCCAGGTACGCTAATGTTGCTGCAGTGTATACACTTA
 
. : . : . : . : . : . :
JMFF050C22+ GGAATACCGTAGCCACGCCATATCTTTTTGCTATTTCAGGAACCCAGTGAGTAGCAAAGT
JMFF036G23+ GGAATACCGCAGCCACGCCATATCTTTTTGCTATTTCAGGAACCCAGTGAGTAGCAAAGT
JMFF002N04+ GGAATACCGTAGCCACGCCATATCTTTTTGCTATTTCAGGAACCCAGTGAGTAGCAAAGT
                      ____________________________________________________________
consensus GGAATACCGTAGCCACGCCATATCTTTTTGCTATTTCAGGAACCCAGTGAGTAGCAAAGT
 
. : . : . : . : . : . :
JMFF050C22+ CGACGAGGATCAGCTCGGGCAAGTCCCGTCTCACGAGCTCCTCGAATGGCGGGCCCATCC
JMFF036G23+ CGACGAGGATCAGCTCGGGCAAGTCCCGTCTCACGAGCTCCTCGAATGGCGGGCCCATCC
JMFF002N04+ CGACGAGGATCAGCTCGGGCAAGTCCCGTCTCACGAGCTCCTCGAATGGCGGGCCCATCC
                      ____________________________________________________________
consensus CGACGAGGATCAGCTCGGGCAAGTCCCGTCTCACGAGCTCCTCGAATGGCGGGCCCATCC
 
. : . : . : . : . : . :
JMFF050C22+ TGTCATACGCCGTTTTCAAGAACTGTACCTGCTCTTGCTGCTCGAGGTCAACAGTCGCCT
JMFF036G23+ TGTCATACGCCGTTTTCAAGAACTGTACCTGCTCTTGCTGCTCGAGGTCAACAGTCGCCT
JMFF002N04+ TGTCATACGCCGTTTTCAAGAACTGTACCTGCTCTTGCTGCTCGAGGTCAACAGTCGCCT
                      ____________________________________________________________
consensus TGTCATACGCCGTTTTCAAGAACTGTACCTGCTCTTGCTGCTCGAGGTCAACAGTCGCCT
 
. : . : . : . : . : . :
JMFF050C22+ CACAATTCTCCGGCAAACCAGGTACCGAGGGCAACGCGATCTCTCTCAGGCTTAATCTCT
JMFF036G23+ CACAATTCTCCGGCAAACCAGGTACCGAGGGCAACGCGATCTCTCTCAGGCTTAATCTCT
JMFF002N04+ CACAATTCTCCGGCAAACCAGGTACCGAGGGCAACGCGATCTCTCTCAGGCTTAATCTCT
                      ____________________________________________________________
consensus CACAATTCTCCGGCAAACCAGGTACCGAGGGCAACGCGATCTCTCTCAGGCTTAATCTCT
 
. : . : . : . : . : . :
JMFF050C22+ CCGTGAAACTCGCAGGAATCGGGGGCAATCTCTGCAGGTTTTTCGGGGTCGACACAAAGG
JMFF036G23+ CCGTGAAACTCGCAGGAATCGGGGGCAATCTCTGCAGGTTTTTCGGGGTCGACACAAAGG
JMFF002N04+ CCGTGAAACTCGCAGGAATCGGGGGCAATCTCTGCAGGTTTTTCGGGGTCGACACAAAGG
                      ____________________________________________________________
consensus CCGTGAAACTCGCAGGAATCGGGGGCAATCTCTGCAGGTTTTTCGGGGTCGACACAAAGG
 
. : . : . : . : . : . :
JMFF050C22+ AAACTCTGAAACCTTTAGCGGCTAATTTCTTGGCAAATTCGAGCATCGGGAGCATATGGC
JMFF036G23+ AAACTCTGAAACCTTTAGCGGCTAATTTCTTGGCAAATTCGAGCATCGGGAGCATATGGC
JMFF002N04+ AAACTCTGAAACCTTTAGCGGCTAATTTCTTGGCAAATTCGAGCATCGGGAGCATATGGC
                      ____________________________________________________________
consensus AAACTCTGAAACCTTTAGCGGCTAATTTCTTGGCAAATTCGAGCATCGGGAGCATATGGC
 
. : . : . : . : . : . :
JMFF050C22+ CAAATGCCAACCACGGGAATATCATCACATGACACTGCTCGGCAGCCATGGTGATGTTCT
JMFF036G23+ CAAATGCCAACCACGGGAATATCATCACATGACACTGCTCGGCAGCCATGGTGATGTTCT
JMFF002N04+ CAAATGCCAACCACGGGAATATCATCACATGACACTGCTCGGCAGCCATGGTGATGTTCT
                      ____________________________________________________________
consensus CAAATGCCAACCACGGGAATATCATCACATGACACTGCTCGGCAGCCATGGTGATGTTCT
 
. : . : . : . : . : . :
JMFF050C22+ AAAACCATAAACTCTCCAACTTGATCCCTATTTGTTTGTTGGAAACATAGGACTGT
JMFF036G23+ AAAACCATAAACTCTCCAACTTGATCCCTATTTGTTTGTTGGAAACATAGGACTGT
JMFF002N04+ AAAACCATAAACTCTCCAACTTGATCCCTATTTGTTTGTTGGAAACATAGGACTGTGATT
                      ____________________________________________________________
consensus AAAACCATAAACTCTCCAACTTGATCCCTATTTGTTTGTTGGAAACATAGGACTGTGATT