Previous Contig 000098:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001P06Sequence485000098 (2)gb:A62523_14500231e-50Sequence 28 from Patent WO9716559.>gb:A72396_1450540 Sequence 28 from Patent EP0199020668
JMFF002K12Sequence520000098 (2)gb:AF190634_17754367e-38Nicotiana tabacum UDP-glucose:salicylic acid glucosyltransferase (SA-GTase) mRNA119020687

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF001P06+ TAAGTAGTTNTAAAGTCGAGTTCCACC
                      ____________________________________________________________
consensus TAAGTAGTTNTAAAGTCGAGTTCCACC
 
. : . : . : . : . : . :
JMFF001P06+ CACAGTGCGTCACGAAACACCCGATGGCAGGATGTGCCAGCATTTCGAGCTGATTGCACC
                      ____________________________________________________________
consensus CACAGTGCGTCACGAAACACCCGATGGCAGGATGTGCCAGCATTTCGAGCTGATTGCACC
 
. : . : . : . : . : . :
JMFF001P06+ ACGAAACAACCAGCCCTTTTCCTCGCGCAGAGTCTACGAACCCTTGGGGCAGTTTGCTCC
                      ____________________________________________________________
consensus ACGAAACAACCAGCCCTTTTCCTCGCGCAGAGTCTACGAACCCTTGGGGCAGTTTGCTCC
 
. : . : . : . : . : . :
JMFF001P06+ GCTCAGATTCCCTCACAACCCAAAGGAAGTTCAACTCTGAGGCTATCAAGGCCCAAGCTA
                      ____________________________________________________________
consensus GCTCAGATTCCCTCACAACCCAAAGGAAGTTCAACTCTGAGGCTATCAAGGCCCAAGCTA
 
. : . : . : . : . : . :
JMFF001P06+ TTTCATCCATTTGTTTAGTGGATAGTGACACCATGCTTCCAAATGAAATATAGACTACCG
JMFF002K12+ GATAGTGACACCATGCTTCCAAATGAAATATAGACTACCG
                      ____________________________________________________________
consensus TTTCATCCATTTGTTTAGTGGATAGTGACACCATGCTTCCAAATGAAATATAGACTACCG
 
. : . : . : . : . : . :
JMFF001P06+ ATTGATTTGGCTTTGATTTCAGCCATTTGAGGCATTCTTCACCAAGGGGTTTCCATAGAC
JMFF002K12+ ATTGATTTGGCTTTGATTTCAGCCATTTGAGGCATTCTTCACCAAGGGGTTTCCATAGAC
                      ____________________________________________________________
consensus ATTGATTTGGCTTTGATTTCAGCCATTTGAGGCATTCTTCACCAAGGGGTTTCCATAGAC
 
. : . : . : . : . : . :
JMFF001P06+ TTGCACCATAACCCTTGTCTCCTTCAATCCTGCCATCTAAGTATGATGAAGGTACCATTG
JMFF002K12+ TTGCACCATAACCCTTGTCTCCTTCAATCCTGCCATCTAAGTATGATGAAGGTACCATTG
                      ____________________________________________________________
consensus TTGCACCATAACCCTTGTCTCCTTCAATCCTGCCATCTAAGTATGATGAAGGTACCATTG
 
. : . : . : . : . : . :
JMFF001P06+ GCCCAATTAGTTTGGCAGGCCAAACTTTTGACACCCCTGCCACCACCTCGGATTCCAATT
JMFF002K12+ GCCCAATTAGTTTGGCAGGCCAAACTTTTGACACCCCTGCCACCACCTCGGATTCCAATT
                      ____________________________________________________________
consensus GCCCAATTAGTTTGGCAGGCCAAACTTTTGACACCCCTGCCACCACCTCGGATTCCAATT
 
. : . : . : . : . : . :
JMFF001P06+ CTTGATAAGTGTTGGCAAATATCCAATCAGCATTTCCC
JMFF002K12+ CTTGATAAGTGTTGGCAAATATCCAATCAGCATTTCCCACGTTGGAGAACTGTCTCATCT
                      ____________________________________________________________
consensus CTTGATAAGTGTTGGCAAATATCCAATCAGCATTTCCCACGTTGGAGAACTGTCTCATCT
 
. : . : . : . : . : . :
JMFF002K12+ TCATAGCCAAGTACGCCGGATAACTATCCGGCGCCGTGATAAAGCTGGGGATATCCGGCC
                      ____________________________________________________________
consensus TCATAGCCAAGTACGCCGGATAACTATCCGGCGCCGTGATAAAGCTGGGGATATCCGGCC
 
. : . : . : . : . : . :
JMFF002K12+ CATACAGCGGCGGAATCCCCGGCAGCACCAACGCCGCCCCGTTCTCCTCAATCTCCACCG
                      ____________________________________________________________
consensus CATACAGCGGCGGAATCCCCGGCAGCACCAACGCCGCCCCGTTCTCCTCAATCTCCACCG
 
. : . : . : . : . : . :
JMFF002K12+ GCAGCTCGAGGCTGCCGCAGTGGATATGCGCGAAAACGGCGCAAACGGCGGCAGAGTTGG
                      ____________________________________________________________
consensus GCAGCTCGAGGCTGCCGCAGTGGATATGCGCGAAAACGGCGCAAACGGCGGCAGAGTTGG
 
. : . : . : . : . : . :
JMFF002K12+ TAAAGAACGCCGCGCCGTGTACGCCGTGCCGCCTCGCCACGTCCAGGGCCCACGGGAAAT
                      ____________________________________________________________
consensus TAAAGAACGCCGCGCCGTGTACGCCGTGCCGCCTCGCCACGTCCAGGGCCCACGGGAAAT