Previous Contig 000097:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002D13Sequence351000097 (22)sp|P35016|ENPL_CATRO1e-34Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -776003099 (25)sp|P35016|ENPL_CATRO6e-74Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF002J08Sequence234000097 (22)sp|P35016|ENPL_CATRO4e-33Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -558003099 (25)sp|P35016|ENPL_CATRO6e-62Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF002K07Sequence573000097 (22)sp|P35016|ENPL_CATRO6e-61Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -695003099 (25)gb:ATAC002343_15427651e-49Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMFF004F13Sequence442000097 (22)sp|P35016|ENPL_CATRO7e-50Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -773003099 (25)gb:AF239931_17799672e-64Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMFF004G14Sequence553000097 (22)sp|P35016|ENPL_CATRO3e-59Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -728003099 (25)sp|P35016|ENPL_CATRO9e-58Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF005J09Sequence445000097 (22)sp|P35016|ENPL_CATRO2e-46Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -727003099 (25)sp|P35016|ENPL_CATRO1e-67Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF007I17Sequence622000097 (22)sp|P35016|ENPL_CATRO1e-66Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -776003099 (25)sp|P35016|ENPL_CATRO4e-74Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF027M12Sequence248000097 (22)sp|P35016|ENPL_CATRO7e-16Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -682003099 (25)gb:ATAC002343_15427653e-54Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMFF034G18Sequence547000097 (22)sp|P35016|ENPL_CATRO1e-56Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -785003099 (25)sp|P35016|ENPL_CATRO1e-70Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFF036O09Sequence563000097 (22)sp|P35016|ENPL_CATRO5e-61Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -762003099 (25)gb:AF239931_17799673e-57Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMFF041G02Sequence643000097 (22)sp|P35016|ENPL_CATRO8e-76Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -599003099 (25)sp|P35016|ENPL_CATRO6e-37Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFS073F08Sequence625000097 (22)sp|P35016|ENPL_CATRO3e-79Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFS104E01Sequence556000097 (22)sp|P35016|ENPL_CATRO2e-77Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFS107H10Sequence630000097 (22)sp|P35016|ENPL_CATRO9e-77Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMFS136B11Sequence433000097 (22)sp|P35016|ENPL_CATRO1e-45Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMSF002I20Sequence359000097 (22)sp|P35016|ENPL_CATRO1e-35Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -736003099 (25)gb:AF239931_17799672e-65Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMSF006C15Sequence235000097 (22)sp|P35016|ENPL_CATRO1e-16Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -334003099 (25)
JMSF007C15Sequence177000097 (22)sp|P35016|ENPL_CATRO3e-07Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -805003099 (25)gb:AF239931_17799672e-64Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMSF007F18Sequence428000097 (22)sp|P35016|ENPL_CATRO1e-48Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -767003099 (25)sp|P35016|ENPL_CATRO1e-67Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMSF011N14Sequence353000097 (22)sp|P35016|ENPL_CATRO1e-34Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -747003099 (25)sp|P35016|ENPL_CATRO3e-67Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -
JMSF030I09Sequence646000097 (22)sp|P35016|ENPL_CATRO2e-76Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -714003099 (25)gb:AF239931_17799676e-62Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.
JMSF040G08Sequence688000097 (22)sp|P35016|ENPL_CATRO3e-84Endoplasmin homolog precursor (GRP94 homolog).>pir|S39558|S39558 HSP90 homolog -906003099 (25)gb:AF239931_17799672e-90Euphorbia esula putative heat-shock protein 90 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS107H10+ TAGAACC
JMFS073F08+ TAGAACC
JMSF040G08+ TTCTACATAGTCAGCCACAAGATAGACAGAATAGAACC
                      ____________________________________________________________
consensus TTCTACATAGTCAGCCACAAGATAGACAGAATAGAACC
 
. : . : . : . : . : . :
JMFS107H10+ CAACACCAAATTGTCCGATGAGGTTAAGGTCTCCACTTGACTGCATTTTCTCAACAAAGG
JMFS073F08+ CAACACCAAATTGTCCGATGAGGTTAAGGTCTCCACTTGACTGCATTTTCTCAACAAAGG
JMSF040G08+ CAACACCAAATTGTCCGATGAGGTTAAGGTCTCCACTTGACTGCATTTTCTCAACAAAGG
JMFF041G02+ CAAATTGTCCGATGAGGTTAAGGTCTCCACTTGACTGCATTTTCTCAACAAAGG
JMSF030I09+ ACCAAATTGTCCGATGAGGTTAAGGTCTCCACTTGACTGCATTTTCTCAACAAAGG
JMFF007I17+ GTCTCCACTTGACTGCATTTTCTCAACAAAGG
                      ____________________________________________________________
consensus CAACACCAAATTGTCCGATGAGGTTAAGGTCTCCACTTGACTGCATTTTCTCAACAAAGG
 
. : . : . : . : . : . :
JMFS107H10+ CTGATGTTCCAGACTTGGCAATGGTTCCCAAGTTCTTAACTAAATCCTCCTTTGTCATCC
JMFS073F08+ CTGATGTTCCAGACTTGGCAATGGTTCCCAAGTTCTTAACTAAATCCTCCTTTGTCATCC
JMSF040G08+ CTGATGTTCCAGACTTGGCAATGGTTCCCAAGTTCTTAACTAAATCCTCCTTTGTCATCC
JMFS104E01+ CTGATGTTCCAGACTTGGCAATGGTTCCCAAGTTCTTAACTAAATCCTCCTTTGTCATCC
JMFF041G02+ CTGATGTTCCAGACTTGGCAATGGTTCCCAAGTTCTTAACTAAATCCTCCTTTGTCATCC
JMFF004G14+ TAACTAAATCCTCCTTTGTCATCC
JMSF030I09+ CTGATGTTCCAGACTTGGCAATGGTTCCCAAGTTCTTAACTAAATCCTCCTTTGTCATCC
JMFF007I17+ CTGATGTTCCAGACTTGGCAATGGTTCCCAAGTTCTTAACTAAATCCTCCTTTGTCATCC
JMFF036O09+ CCCAAGTTCTTAACTAAATCCTCCTTTGTCATCC
JMFF034G18+ TGTCATCC
JMFF002J08+ CCTTTGTCATCC
JMFF002K07+ CCCAAGTTCTTAACTAAATCCTCCTTTGTCATCC
                      ____________________________________________________________
consensus CTGATGTTCCAGACTTGGCAATGGTTCCCAAGTTCTTAACTAAATCCTCCTTTGTCATCC
 
. : . : . : . : . : . :
JMFS107H10+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
JMFS073F08+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
JMSF040G08+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
JMFS104E01+ CAATTCCTCTGTCACGAATTGAAAGAATTNTCTTGTCTTTGTCCAATTTAATCTGGATCT
JMFF041G02+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
JMFF004G14+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
JMSF030I09+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
JMFF007I17+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
JMFF036O09+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
JMFF034G18+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
JMFF002J08+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTNGTCTTTGTCCAATTTAATCTGGATCT
JMFF002K07+ CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
                      ____________________________________________________________
consensus CAATTCCTCTGTCACGAATTGAAAGAATTTTCTTGTCTTTGTCCAATTTAATCTGGATCT
 
. : . : . : . : . : . :
JMFS107H10+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFS073F08+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMSF040G08+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFS104E01+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFF041G02+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFF004G14+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMSF030I09+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFF007I17+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFF036O09+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFF034G18+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFF005J09+ CAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFF004F13+ GTCAGTGAGTGAAAGGAATCTGA
JMSF007F18+ GTGAGTGAAAGGAATCTGA
JMFS136B11+ ATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFF002J08+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
JMFF002K07+ CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
                      ____________________________________________________________
consensus CAAGCTTAGCAGTATCACCTTCACCCAATATATCCTTGTCAGTGAGTGAAAGGAATCTGA
 
. : . : . : . : . : . :
JMFS107H10+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFS073F08+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMSF040G08+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFS104E01+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFF041G02+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFF004G14+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMSF030I09+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFF007I17+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFF036O09+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFF034G18+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFF005J09+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFF004F13+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMSF007F18+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFS136B11+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMSF002I20+ CTTTGTTAC
JMSF011N14+ C
JMFF002J08+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
JMFF002K07+ TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
                      ____________________________________________________________
consensus TCTTGTCCAATGCATCCGAAGCGTTGGAGATCAGCTCCCTCAAGAAAATATCTTTGTTAC
 
. : . : . : . : . : . :
JMFS107H10+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFS073F08+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMSF040G08+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFS104E01+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFF041G02+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFF004G14+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMSF030I09+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFF007I17+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFF036O09+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFF034G18+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFF005J09+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFF004F13+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMSF007F18+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFS136B11+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMSF002I20+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACNTCAGCCTGGAACTCAAATT
JMSF011N14+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFF002D13+ GTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
JMFF002J08+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCT
JMFF002K07+ TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
                      ____________________________________________________________
consensus TGTAAAGGGAATTGATAATGATGTCCATAAGCCGAGAAACCTCAGCCTGGAACTCAAATT
 
. : . : . : . : . : . :
JMFS107H10+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMFS073F08+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMSF040G08+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMFS104E01+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMFF041G02+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMFF004G14+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMSF030I09+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMFF007I17+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCC-TTTAGCCACAT
JMFF036O09+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMFF034G18+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMFF005J09+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCC-TTTAGCCACAT
JMFF004F13+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMSF007F18+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMFS136B11+ TGTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGATTCAGCTTCCCTTTTAGCCACAT
JMSF002I20+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMSF011N14+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMFF002D13+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
JMFF027M12+ TAGCCACAT
JMSF006C15+ AGCCACAT
JMFF002K07+ TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
                      ____________________________________________________________
consensus TCTCCGCACCAGCTCGGAGTGTCCTCTTTGACATGGACTCAGCTTCCCTTTTAGCCACAT
 
. : . : . : . : . : . :
JMFS107H10+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFS073F08+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMSF040G08+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFS104E01+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFF041G02+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFF004G14+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMSF030I09+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFF007I17+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFF036O09+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFF034G18+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFF005J09+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFF004F13+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMSF007F18+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFS136B11+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMSF002I20+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMSF011N14+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFF002D13+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFF027M12+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMSF007C15+ TTGGGAGGAT
JMSF006C15+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
JMFF002K07+ CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
                      ____________________________________________________________
consensus CAGGATCGGTGGATAAACCATGCGGAACACCACCAATCTTTTCTTCAACCTTGGGAGGAT
 
. : . : . : . : . : . :
JMFS107H10+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFS073F08+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMSF040G08+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFS104E01+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFF041G02+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFF004G14+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMSF030I09+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFF007I17+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFF036O09+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFF034G18+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFF005J09+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFF004F13+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMSF007F18+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFS136B11+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCCAGGCCTTGATCCGGA
JMSF002I20+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMSF011N14+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFF002D13+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFF027M12+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCNTGATCCGGA
JMSF007C15+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMSF006C15+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
JMFF002K07+ CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
                      ____________________________________________________________
consensus CCACTGGTGCATCAGAATCAACTTCTGCATTGGCGTGTATCTTCC-GGCCTTGATCCGGA
 
. : . : . : . : . : . :
JMFS107H10+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCGACTTCCTCATTGTT
JMFS073F08+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMSF040G08+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFS104E01+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFF041G02+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFF004G14+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMSF030I09+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFF007I17+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFF036O09+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFF034G18+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFF005J09+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFF004F13+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMSF007F18+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFS136B11+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMSF002I20+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMSF011N14+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFF002D13+ AGAAGAAAGAGAAGGNATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFF027M12+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMSF007C15+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMSF006C15+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
JMFF002K07+ AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
                      ____________________________________________________________
consensus AGAAGAAAGAGAAGGCATAGTAGAAACAGCACGGCCGGGACCGCCCACTTCCTCATTGTT
 
. : . : . : . : . : . :
JMFS107H10+ ACCGTCGACTCGATTTCTCCTCAC
JMFS073F08+ ACCGTCGACTCGATTTC
JMSF040G08+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCT
JMFS104E01+ ACCGTCGACTCGATTTC
JMFF041G02+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTATGCT
JMFF004G14+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTATGCT
JMSF030I09+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCT
JMFF007I17+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCTAT
JMFF036O09+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCT
JMFF034G18+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCTATCACGATGA
JMFF005J09+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCTAT
JMFF004F13+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCTATCACGATGA
JMSF007F18+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGC
JMFS136B11+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAG
JMSF002I20+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCT
JMSF011N14+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCTA
JMFF002D13+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTC
JMFF027M12+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCTATCACGATGA
JMSF007C15+ ACCGTCGACTCGATTTCTCTTCACGAAGTTGCCGAAGAAGAAGCTCT
JMSF006C15+ ACCGTCGACTCGATTTCTCTTCACGAAGTTGCCGAAGAAGAAGCTCT
JMFF002K07+ ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCTATCACGATGA
                      ____________________________________________________________
consensus ACCGTCGACTCGATTTCTCCTCACGAAGTTGCCGAAGAAGAAGCTCTGCTATCACGATGA