Previous Contig 000096:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002J18Sequence523000096 (11)gb:AF286719_17832135e-47Arabidopsis thaliana XRN3 (XRN3) mRNA, complete cds.
JMFF010I11Sequence543000096 (11)gb:AF286719_17832132e-50Arabidopsis thaliana XRN3 (XRN3) mRNA, complete cds.780008653 (3)gb:AP004669_18430120.002Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049
JMFF020C18Sequence536000096 (11)gb:AF286719_17832134e-50Arabidopsis thaliana XRN3 (XRN3) mRNA, complete cds.671008653 (3)gb:AP004669_18430120.003Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049
JMFF051L10Sequence522000096 (11)gb:AF286719_17832132e-47Arabidopsis thaliana XRN3 (XRN3) mRNA, complete cds.446008653 (3)
JMFS020G06Sequence629000096 (11)gb:AP004669_18430121e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049
JMFS041D03Sequence660000096 (11)gb:AP004669_18430121e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049
JMFS093H07Sequence616000096 (11)gb:AP004669_18430122e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049
JMFS112E09Sequence626000096 (11)gb:AF286719_17832138e-52Arabidopsis thaliana XRN3 (XRN3) mRNA, complete cds.
JMFS133H08Sequence626000096 (11)gb:AP004669_18430122e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049
JMFS147G10Sequence627000096 (11)gb:AP004669_18430128e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049
JMFS168D01Sequence617000096 (11)gb:AF286719_17832132e-48Arabidopsis thaliana XRN3 (XRN3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS020G06+ CTTAATGTTTCTCCATCCAGGATCATAGTTTAGCCTGAGAT
JMFS133H08+ T
JMFS041D03+ AGCCTGAGAT
                      ____________________________________________________________
consensus CTTAATGTTTCTCCATCCAGGATCATAGTTTAGCCTGAGAT
 
. : . : . : . : . : . :
JMFS020G06+ GAATGTAGTACTGGAGTGCAATTGACAAAGTGGCCATGAAGGGAGTTCCAGGAGTGATAA
JMFS133H08+ GAATGTAGTACTGGAGTGCAATTGACAAAGTGGCCATGAAGGGAGTTCCAGGAGTGATAA
JMFS041D03+ GAATGTAGTACTGNAGT-CAATTGACAAAGTGGCCATGAAGGGAGTTCCAGGAGTGATAA
JMFS147G10+ GTTCCAGGAGTGATAA
JMFS112E09+ GAGTTCCAGGAGTGATAA
                      ____________________________________________________________
consensus GAATGTAGTACTGGAGTGCAATTGACAAAGTGGCCATGAAGGGAGTTCCAGGAGTGATAA
 
. : . : . : . : . : . :
JMFS020G06+ CATTTGAATC-AAAAGTTTGTGATTCCTGCTTGGGAGGAAGCTTCCTACCCTCCTGCTCA
JMFS133H08+ CATTTGAATC-AAAAGTTTGTGATTCCTGCTTGGGAGGAAGCTTCCTACCCTCCTGCTCA
JMFS041D03+ CA-TTGAATC-AANAGTTTGTGATTCCTGCTTGGGAGGAAGCTTCCTACCCTCCTGCTCA
JMFS147G10+ CATTTGAATC-AAAAGTTTGTGATTCCTGCTTGGGAGGAAGCTTCCTACCCTCCTGCTCA
JMFS112E09+ CA-TTGAATC-AAAAGT-TGTGATTCCTGC-TGGGAGGAAGCTTCCTACCCTCCTGCTCA
JMFS093H07+ CATTTGAATCAAAAAGTNTGTGATTCCTGCTTGGGAGGAAGCTTCCTACCCTCCTGCTCA
JMFS168D01+ TGATTCCTGC-TGGGAGGAAGCTTCCTACCCTCCTGCTCA
                      ____________________________________________________________
consensus CATTTGAATC-AAAAGTTTGTGATTCCTGCTTGGGAGGAAGCTTCCTACCCTCCTGCTCA
 
. : . : . : . : . : . :
JMFS020G06+ AACTCCTCACGCAACCTTTCCTCTTCAGCTGCCGCTTCAGCTGCATCTTTTGCGGCTCTA
JMFS133H08+ AACTCCTCACGCAACCTTTCCTCTTCAGCTGCCGCTTCAGCTGCATCTTTTGCGGCTCTA
JMFS041D03+ AACTCCTCACGCAACCTTTCCTCTTCAGCTGCCGCTTCAGCTGCATCTTNTGCGGCTCTA
JMFS147G10+ AACTCCTCACGCAACCTTTCCTCTTCAGCTGCCGCTTCAGCTGCATCTTTTGCGGCTCTA
JMFS112E09+ AACTCCTCACGCAACCTTTCCTCTTCAGCTGCCGCTTCAGCTGCATCTTTTGCGGCTCTA
JMFS093H07+ AACTCCTCACGCAACCTTTCCTCTTCAGCTGCCGCTTCAGCTGCATCTTTTGCGGCTCTA
JMFS168D01+ AACTCCTCACGCAACCTTTCCTCTTCAGCTGCCGCTTCAGCTGCATCTTNTGCGGCTCTA
JMFF010I11+ CTA
                      ____________________________________________________________
consensus AACTCCTCACGCAACCTTTCCTCTTCAGCTGCCGCTTCAGCTGCATCTTTTGCGGCTCTA
 
. : . : . : . : . : . :
JMFS020G06+ AAACGCCTAGACCTTTGCTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
JMFS133H08+ AAACGCCTAGACCTTTGCTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
JMFS041D03+ AAACGCCTAGACCTTTGCTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
JMFS147G10+ AAACGCCTAGACCTTTGCTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
JMFS112E09+ AAACGCCTAGACCTTTGCTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
JMFS093H07+ AAACGCCTAGACCTTTGCTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
JMFS168D01+ AAACGCCTAGACCTTTGCTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
JMFF051L10+ TGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
JMFF020C18+ GCCTAGACCTTTGCTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
JMFF010I11+ AAACGCCTAGACCTTTGCTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
JMFF002J18+ CTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
                      ____________________________________________________________
consensus AAACGCCTAGACCTTTGCTGATTCATTTTAGCTCTTGGAGCAACACCATCAATAGCCATG
 
. : . : . : . : . : . :
JMFS020G06+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
JMFS133H08+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
JMFS041D03+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
JMFS147G10+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
JMFS112E09+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
JMFS093H07+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
JMFS168D01+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
JMFF051L10+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
JMFF020C18+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
JMFF010I11+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
JMFF002J18+ TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
                      ____________________________________________________________
consensus TACAGTAGCTTTCGAGGGCGCACCATTACAAAGAGCCTGTCTATATAGTCAAACATGCAT
 
. : . : . : . : . : . :
JMFS020G06+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
JMFS133H08+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTAAAAACACGGGTGA
JMFS041D03+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
JMFS147G10+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
JMFS112E09+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
JMFS093H07+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
JMFS168D01+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
JMFF051L10+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
JMFF020C18+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
JMFF010I11+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
JMFF002J18+ CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
                      ____________________________________________________________
consensus CGAAATACCTCCTCGAATGTGGTAGGAGAAGGTCGATCTTCGGGGTGAAAACACGGGTGA
 
. : . : . : . : . : . :
JMFS020G06+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
JMFS133H08+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
JMFS041D03+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
JMFS147G10+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
JMFS112E09+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
JMFS093H07+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
JMFS168D01+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
JMFF051L10+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
JMFF020C18+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
JMFF010I11+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
JMFF002J18+ ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
                      ____________________________________________________________
consensus ATAATACCATTCATATCTAGATAGAGGTTATCGAATTCGATATTATTTGGATTAGGTTTA
 
. : . : . : . : . : . :
JMFS020G06+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
JMFS133H08+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
JMFS041D03+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
JMFS147G10+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
JMFS112E09+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
JMFS093H07+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
JMFS168D01+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
JMFF051L10+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
JMFF020C18+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
JMFF010I11+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
JMFF002J18+ CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
                      ____________________________________________________________
consensus CTGGTATCCACCGGAATTTTTACTCCTTCGATAACCACCGCCTCTTCCTCGATCACATCC
 
. : . : . : . : . : . :
JMFS020G06+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGGAACTCCCATTTTC
JMFS133H08+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGGAACTCCCATTTTC
JMFS041D03+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGGAACTCCCATTTTC
JMFS147G10+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGGAACTCCCATTTTC
JMFS112E09+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGGAACTCCCATTTTC
JMFS093H07+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGGAACTCCCATTTTC
JMFS168D01+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGGAACTCCCATTTTC
JMFF051L10+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGGAACTCCCATTTTC
JMFF020C18+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGGAACTCCCATTTTC
JMFF010I11+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGTAACTCCCATTTTC
JMFF002J18+ ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGTAACTCCCATTTTC
                      ____________________________________________________________
consensus ACCACCACCATCGAATACTTCTCCGCCAGCCACCGGTAAAATGCCGGAACTCCCATTTTC
 
. : . : . : . : . : . :
JMFS020G06+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAAC
JMFS133H08+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
JMFS041D03+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
JMFS147G10+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
JMFS112E09+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
JMFS093H07+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
JMFS168D01+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
JMFF051L10+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
JMFF020C18+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
JMFF010I11+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
JMFF002J18+ GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
                      ____________________________________________________________
consensus GCCCAATTCTAAACAAAACCGCTGAATCTCGCACAGAACTCCAATCAACGTATGTATGTA
 
. : . : . : . : . : . :
JMFS133H08+ TGCAAGTGTATATATGTATATTAATA
JMFS041D03+ TGCAAGTGTATATATGTATATTAATATGTAGTAGTAAATCGGAAGGAAGA
JMFS147G10+ TGCAAGTGTATATATGTATATTAATATGTAGTAGTAAATCGGAAGGAAGATAAATGAATT
JMFS112E09+ TGCAAGTGTATATATGTATATTAATATGTAGTAGTAAATCGGAAGGAAGATAAATGAATT
JMFS093H07+ TGCAAGTGTATATATGTATATTAATATGTAGTAGTAAATCGGAAGGAAGATAAATGAATT
JMFS168D01+ TGCAAGTGTATATATGTATATTAATATGTAGTAGTAAATCGGAAGGAAGATAAATGAATT
JMFF051L10+ TGCAAGTGTATATATGTATATTAATATGTAGTAGTAAATCGGAAGGAAGATAAATGAATT
JMFF020C18+ TGCAAGTGTATATATGTATATTAATATGTAGTAGTAAATCGGAAGGAAGATAAATGAATT
JMFF010I11+ TGCAAGTGTATATATGTATATTAATATGTAGTAGTAAATCGGAAGGAAGATAAATGAATT
JMFF002J18+ TGCAAGTGTATATATGTATATTAATATGTAGTAGTAAATCGGAAGGAAGATAAATGAATT
                      ____________________________________________________________
consensus TGCAAGTGTATATATGTATATTAATATGTAGTAGTAAATCGGAAGGAAGATAAATGAATT
 
. : . : . : . : . : . :
JMFS147G10+ TGAAGAAGAAAA
JMFS112E09+ TGAAGAAGAAAA
JMFS093H07+ TGAAGAAGAAAAGAAA
JMFS168D01+ TGAAGAAGAAAAGAAAGAAGTAGAACGACGTTAAGCAA
JMFF051L10+ TGAAGAAGAAAAGAAAGAAGTAGAACGACGTTAAGCAAGATGCAAAGAAATCAAGAATA
JMFF020C18+ TGAAGAAGAAAAGAAAGAAGTAGAACGACGTTAAGCAAGATGCAAAGAAATCAAGAATA
JMFF010I11+ TGAAGAAGAAAAGAAAGAAGTAGAACGACGTTAAGCAAGATGCAAAGAAATCAAGAATA
JMFF002J18+ TGAAGAAGAAAAGAAAGAAGTAGAACGACGTTAAGCAAGATGCAAAGAAATCAAGAATAG
                      ____________________________________________________________
consensus TGAAGAAGAAAAGAAAGAAGTAGAACGACGTTAAGCAAGATGCAAAGAAATCAAGAATAG