Previous Contig 000090:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002I17Sequence573000090 (4)sp|O48921|C972_SOYBN7e-22Cytochrome P450 97B2 (EC 1.14.-.-).>pir|T05904|T05904 cytochrome P450 97B2p - so736008207 (6)sp|O48921|C972_SOYBN4e-70Cytochrome P450 97B2 (EC 1.14.-.-).>pir|T05904|T05904 cytochrome P450 97B2p - so
JMFF013F11Sequence550000090 (4)sp|O48921|C972_SOYBN9e-18Cytochrome P450 97B2 (EC 1.14.-.-).>pir|T05904|T05904 cytochrome P450 97B2p - so754008207 (6)sp|O48921|C972_SOYBN8e-73Cytochrome P450 97B2 (EC 1.14.-.-).>pir|T05904|T05904 cytochrome P450 97B2p - so
JMSF001F10Sequence382000090 (4)sp|O48921|C972_SOYBN9e-05Cytochrome P450 97B2 (EC 1.14.-.-).>pir|T05904|T05904 cytochrome P450 97B2p - so722008207 (6)sp|O48921|C972_SOYBN3e-70Cytochrome P450 97B2 (EC 1.14.-.-).>pir|T05904|T05904 cytochrome P450 97B2p - so
JMSF018F12Sequence541000090 (4)sp|O48921|C972_SOYBN1e-40Cytochrome P450 97B2 (EC 1.14.-.-).>pir|T05904|T05904 cytochrome P450 97B2p - so752008207 (6)sp|O48921|C972_SOYBN1e-80Cytochrome P450 97B2 (EC 1.14.-.-).>pir|T05904|T05904 cytochrome P450 97B2p - so

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018F12+ TCATATGAG
                      ____________________________________________________________
consensus TCATATGAG
 
. : . : . : . : . : . :
JMSF018F12+ AATGCATTTTCACGAAGAATATGCCTTGCCACAATGGGATCTGATACAACTACGAATGCT
                      ____________________________________________________________
consensus AATGCATTTTCACGAAGAATATGCCTTGCCACAATGGGATCTGATACAACTACGAATGCT
 
. : . : . : . : . : . :
JMSF018F12+ TTCGGCCCAAAAGCAAGTTTATACACCGAGCCATACTTTAAGAACCAGTCGTACAGTGAG
                      ____________________________________________________________
consensus TTCGGCCCAAAAGCAAGTTTATACACCGAGCCATACTTTAAGAACCAGTCGTACAGTGAG
 
. : . : . : . : . : . :
JMSF018F12+ AAGAAAAGTGGCCGACCAAAAAGATCAGAAACAGCACCTTCAGCAGTAGGCATGGACCCA
                      ____________________________________________________________
consensus AAGAAAAGTGGCCGACCAAAAAGATCAGAAACAGCACCTTCAGCAGTAGGCATGGACCCA
 
. : . : . : . : . : . :
JMSF018F12+ ATTTTTCCCCCACTCAACAGATTAGTGAGGAGATTGCTTGCATTGTCTAACAAATTCATT
JMSF001F10+ CCCCACTCAACAGATTAGTGAGGAGATTGCTTGCATTGTCTAACAAATTCATT
                      ____________________________________________________________
consensus ATTTTTCCCCCACTCAACAGATTAGTGAGGAGATTGCTTGCATTGTCTAACAAATTCATT
 
. : . : . : . : . : . :
JMSF018F12+ TTTGTTTTGCGCTCATCCGTACTAGTGGACTGGCACCGAATTCGACACCCTCCACTGGGC
JMSF001F10+ TTTGTTTTGCGCTCATCCGTACTAGTGGACTGGCACCGAATTCGACACCCTCCACTGGGC
JMFF013F11+ CCGAATTCGACACCCTCCACTGGGC
JMFF002I17+ CCGAATTCGACACCCTCCACTGGGC
                      ____________________________________________________________
consensus TTTGTTTTGCGCTCATCCGTACTAGTGGACTGGCACCGAATTCGACACCCTCCACTGGGC
 
. : . : . : . : . : . :
JMSF018F12+ TTCATCTTGAAGGAACTGCCATGACTATGTCTAGTACCCGCAGTCCTAGAAGAAATAGAG
JMSF001F10+ TTCATCTTGAAGGAACTGCCATGACTATGTCTAGTACCCGCAGTCCTAGAAGAAATAGAG
JMFF013F11+ TTCATCTTGAAGGAACTGCCATGACTATGTCTAGTACCCGCAGTCCTAGAAGAAATAGAG
JMFF002I17+ TTCATCTTGAAGGAACTGCCATGACTATGTCTAGTACCCGCAGTCCTAGAAGAAATAGAG
                      ____________________________________________________________
consensus TTCATCTTGAAGGAACTGCCATGACTATGTCTAGTACCCGCAGTCCTAGAAGAAATAGAG
 
. : . : . : . : . : . :
JMSF018F12+ GGCAAACCAATACAAGAACGGCCGAGCCCACAGTCAGTGTGAGTAGCAGCAACGCAGCAC
JMSF001F10+ GGCAAACCAATACAAGAACGGCCGAGCCCACAGTCAGTGTGAGTAGCAGCAACGCAGCAC
JMFF013F11+ GGCAAACCAATACAAGAACGGCCGAGCCCACAGTCAGTGTGAGTAGCAGCAACGCAGCAC
JMFF002I17+ GGCAAACCAATACAAGAACGGCCGAGCCCACAGTCAGTGTGAGTAGCAGCAACGCAGCAC
                      ____________________________________________________________
consensus GGCAAACCAATACAAGAACGGCCGAGCCCACAGTCAGTGTGAGTAGCAGCAACGCAGCAC
 
. : . : . : . : . : . :
JMSF018F12+ CCAGTCGCCATAGACTTTTATCAAACAGATGGAGTGCAAGAATCCTAAGAACCAAGGAGA
JMSF001F10+ CCAGTCGCCATAGACTTTTATCAAACAGATGGAGTGCAAGAATCCTAAGAACCAAGGAGA
JMFF013F11+ CCAGTCGCCATAGACTTTTATCAAACAGATGGAGTGCAAGAATCCTAAGAACCAAGGAGA
JMFF002I17+ CCAGTCGCCATAGACTTTTATCAAACAGATGGAGTGCAAGAATCCTAAGAACCAAGGAGA
                      ____________________________________________________________
consensus CCAGTCGCCATAGACTTTTATCAAACAGATGGAGTGCAAGAATCCTAAGAACCAAGGAGA
 
. : . : . : . : . : . :
JMSF018F12+ CGAAGAGCCGAGGTGAGGCGAGCTGAGCTCAGATTTACAGCAATGGAGTGC
JMSF001F10+ CGAAGAGCCGAGGTGAGGCGAGCTGAGCTCAGATTTACAGCAATGGAGTGCAAATTGGTG
JMFF013F11+ CGAAGAGCCGAGGTGAGGCGAGCTGAGCTCAGATTTACAGCAATGGAGTGCAAATTGGTG
JMFF002I17+ CGAAGAGCCGAGGTGAGGCGAGCTGAGCTCAGATTTACAGCAATGGAGTGCAAATTGGTG
                      ____________________________________________________________
consensus CGAAGAGCCGAGGTGAGGCGAGCTGAGCTCAGATTTACAGCAATGGAGTGCAAATTGGTG
 
. : . : . : . : . : . :
JMSF001F10+ CGCCTGCTTTCCAGTGAACTGTATTTGC
JMFF013F11+ CGCCTGCTTTCCAGTGAACTGTATTTGCGCTCTACCCACTGACGAAGCGCAACTCCCATG
JMFF002I17+ CGCCTGCTTTCCAGTGAACTGTATTTGCGCTCTACCCACTGACGAAGCGCAACTCCCATG
                      ____________________________________________________________
consensus CGCCTGCTTTCCAGTGAACTGTATTTGCGCTCTACCCACTGACGAAGCGCAACTCCCATG
 
. : . : . : . : . : . :
JMFF013F11+ TGTGAGAGACACGTGGATATATTTGTCCGAAAATGCGGAAGTTGGGCCAACAAGGCAACC
JMFF002I17+ TGTGAGAGACACGTGGATATATTTGTCCGAAAATGCGGAAGTTGGGCCAACAAGGCAACC
                      ____________________________________________________________
consensus TGTGAGAGACACGTGGATATATTTGTCCGAAAATGCGGAAGTTGGGCCAACAAGGCAACC