Previous Contig 000087:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H23Sequence445000087 (8)sp|P37830|G6PD_SOLTU3e-27Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p134013291 (6)
JMFF021L10Sequence497000087 (8)sp|P37830|G6PD_SOLTU5e-46Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p609013291 (6)gb:NTTCG6_16917938e-56Nicotiana tabacum mRNA cytosolic glucose-6-phosphate dehydrogenase TCG6.
JMFF039N23Sequence186000087 (8)
JMFS152G08Sequence607000087 (8)sp|P37830|G6PD_SOLTU4e-52Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p
JMFS166F05Sequence620000087 (8)sp|P37830|G6PD_SOLTU7e-74Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p
JMSF009B22Sequence315000087 (8)sp|P37830|G6PD_SOLTU2e-18Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p767013291 (6)gb:NTTCG6_16917932e-87Nicotiana tabacum mRNA cytosolic glucose-6-phosphate dehydrogenase TCG6.
JMSF018L23Sequence191000087 (8)704013291 (6)gb:NTTCG6_16917932e-69Nicotiana tabacum mRNA cytosolic glucose-6-phosphate dehydrogenase TCG6.
JMSF040I11Sequence707000087 (8)sp|P37830|G6PD_SOLTU9e-85Glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform (EC 1.1.1.49) (G6PD).>p872013291 (6)gb:NTTCG9_1691794e-100Nicotiana tabacum mRNA for cytosolic glucose-6-phosphate dehydrogenase TCG9.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040I11+ AGCTGNAGCCAAA
                      ____________________________________________________________
consensus AGCTGNAGCCAAA
 
. : . : . : . : . : . :
JMFS166F05+ ATCAGATTTATTC
JMSF040I11+ TCCCTACCAAAGGGCTTCTCAACAACGATGCGTGTCCATCCACCAAGATCAGATTTATTC
                      ____________________________________________________________
consensus TCCCTACCAAAGGGCTTCTCAACAACGATGCGTGTCCATCCACCAAGATCAGATTTATTC
 
. : . : . : . : . : . :
JMFS166F05+ ATGCAATAAAACTTTATCATTCTGCACACAGATGGATATACTGATGGAGNAAGTGCAAGG
JMSF040I11+ ATGCAATAAAACTTTATCATTCTGCACACAGATGGATATACTGATGGAGGAAGTGCAAGG
                      ____________________________________________________________
consensus ATGCAATAAAACTTTATCATTCTGCACACAGATGGATATACTGATGGAGGAAGTGCAAGG
 
. : . : . : . : . : . :
JMFS166F05+ TAGAAGAGCCTTCTGGAAGATCCTTCAGTGCTATTTTTTGATACTTCATGCTCATATATT
JMSF040I11+ TAGAAGAGCCTTCTGGAAGATCCTTCAGTGCTATTTTTTGATACTTCATGCTCATATATT
JMFS152G08+ ATACTTCATGCTCATATATG
                      ____________________________________________________________
consensus TAGAAGAGCCTTCTGGAAGATCCTTCAGTGCTATTTTTTGATACTTCATGCTCATATATT
 
. : . : . : . : . : . :
JMFS166F05+ GCCTTATCTAATGACCGAAATCCCTCCTCGGAGTCATAACCACCAGATACATATTTTATC
JMSF040I11+ GCCTTATCTAATGACCGAAATCCCTCCTCGGAGTCATAACCACCAGATACATATTTTATC
JMFF021L10+ CCTCGGAGTCATAACCACCAGATACATATTTTATC
JMFS152G08+ CCCTTATCTAATGACCGAAATCCCTCCTCGGAGTCATAACCACCAGATACATATTTTATC
                      ____________________________________________________________
consensus GCCTTATCTAATGACCGAAATCCCTCCTCGGAGTCATAACCACCAGATACATATTTTATC
 
. : . : . : . : . : . :
JMFS166F05+ AATTGCAGAAAATTTGGAACAGTTTCTGCATTATCTTTTCCCGGGGAAAGATACCCACGA
JMSF040I11+ AATTGCAGAAAATTTGGAACAGTTTCTGCATTATCTTTTCCCGGGGAAAGATACCCACGA
JMFF021L10+ AATTGCAGAAAATTTGGAACAGTTTCTGCATTATCTTTTCCCGGGGAAAGATACCCACGA
JMFS152G08+ AATTGCAGAAAATTTGGAACAGTTTCTGCATTATCTTTTCCCGGGGAAAGATACCCACGA
                      ____________________________________________________________
consensus AATTGCAGAAAATTTGGAACAGTTTCTGCATTATCTTTTCCCGGGGAAAGATACCCACGA
 
. : . : . : . : . : . :
JMFS166F05+ ATACGGTCTCTCAAGTCATCATCTGAAATTTTGGTCCTTGCATAGCCAAAAATGTGAACG
JMSF040I11+ ATACGGTCTCTCAAGTCATCATCTGAAATTTTGGTCCTTGCATAGCCAAAAATGTGAACG
JMFF021L10+ ATACGGTCTCTCAAGTCATCATCTGAAATTTTGGTCCTTGCATAGCCAAAAATGTGAACG
JMFS152G08+ ATACGGTCTCTCAAGTCATCATCTGAAATTTTGGTCCTTGCATAGCCAAAAATGTGAACG
JMFF002H23+ CCTTGCATAGCCAAAAATGTGAACG
                      ____________________________________________________________
consensus ATACGGTCTCTCAAGTCATCATCTGAAATTTTGGTCCTTGCATAGCCAAAAATGTGAACG
 
. : . : . : . : . : . :
JMFS166F05+ TCATTAGATTGCAAGAACCCCTGGTGGTAGAGGTTGAACAGTGCAGGAAAAGTCTTCTTT
JMSF040I11+ TCATTAGATTGCAAGAACCCCTGGTGGTAGAGGTTGAACAGTGCAGGAAAAGTCTTCTTT
JMFF021L10+ TCATTAGATTGCAAGAACCCCTGGTGGTAGAGGTTGAACAGTGCAGGAAAAGTCTTCTTT
JMFS152G08+ TCATTAGATTGCAAGAACCCCTGGTGGTAGAGGTTGAACAGTGCAGGAAAAGTCTTCTTT
JMSF009B22+ CTGGTGGTAGAGGTTGAACAGTGCAGGAAAAGTCTTCTTT
JMFF002H23+ TCATTAGATTGCAAGAACCCCTGGTGGTAGAGGTTGAACAGTGCAGGAAAAGTCTTCTTT
                      ____________________________________________________________
consensus TCATTAGATTGCAAGAACCCCTGGTGGTAGAGGTTGAACAGTGCAGGAAAAGTCTTCTTT
 
. : . : . : . : . : . :
JMFS166F05+ TTGGCAAGATCACCAGAAGCACCAAGAACAACAATGGAGAGGCACCCAGTTTCAGTCACA
JMSF040I11+ TTGGCAAGATCACCAGAAGCACCAAGAACAACAATGGAGAGGCACCCAGTTTCAGTCACA
JMFF021L10+ TTGGCAAGATCACCAGAAGCACCAAGAACAACAATGGAGAGGCACCCAGTTTCAGTCACA
JMFS152G08+ TTGGCAAGATCACCAGAAGCACCAAGAACAACAATGGAGAGGCACCCAGTTTCAGTCACA
JMSF009B22+ TTGGCAAGATCACCAGAAGCACCAAGAACAACAATGGAGAGGCACCCAGTTTCAGTCACA
JMFF002H23+ TTGGCAAGATCACCAGAAGCACCAAGAACAACAATGGAGAGGCACCCAGTTTCAGTCACA
                      ____________________________________________________________
consensus TTGGCAAGATCACCAGAAGCACCAAGAACAACAATGGAGAGGCACCCAGTTTCAGTCACA
 
. : . : . : . : . : . :
JMFS166F05+ CCTTCAATGTCTGCAAAGGAGTCATTGCTAACAAGACCCCTTTTCTCCACACACCATTGT
JMSF040I11+ CCTTCAATGTCTGCAAAGGAGTCATTGCTAACAAGACCCCTTTTCTCCACACACCATTGT
JMFF021L10+ CCTTCAATGTCTGCAAAGGAGTCATTGCTAACAAGACCCCTTTTCTCCACACACCATTGT
JMFF039N23+ ACCATTGT
JMFS152G08+ CCTTCAATGTCTGCAAAGGAGTCATTGCTAACAAGACCCCTTTTCTCCACACACCATTGT
JMSF009B22+ CCTTCAATGTCTGCAAAGGAGTCATTGCTAACAAGACCCCTTTTCTCCACACACCATTGT
JMSF018L23+ CAAAGGAGTCATTGCTAACAAGACCCCTTTTCTCCACACACCATTGT
JMFF002H23+ CCTTCAATGTCTGCAAAGGAGTCATTGCTAACAAGACCCCTTTTCTCCACACACCATTGT
                      ____________________________________________________________
consensus CCTTCAATGTCTGCAAAGGAGTCATTGCTAACAAGACCCCTTTTCTCCACACACCATTGT
 
. : . : . : . : . : . :
JMFS166F05+ GCAGATTCCATCTTAAAAGCTTCTAGTCTAGTGAGAAGCCCAAATTCAATTACTTGTTCA
JMSF040I11+ GCAGATTCCATCTTAAAAGCTTCTAGTCTAGTGAGAAGCCCAAATTCAATTACTTGTTCA
JMFF021L10+ GCAGATTCCATCTTAAAAGCTTCTAGTCTAGTGAGAAGCCCAAATTCAATTACTTGTTCA
JMFF039N23+ GCAGATTCCATCTTAAAAGCTTTTAGTCTAGTGAGAAGCCCAAATTCAATTACTTGTTCA
JMFS152G08+ GCAGATTCCATCTTAAAAGCTTCTAGTCTAGTGAGAAGCCCAAATTCAATTACTTGTTCA
JMSF009B22+ GCAGATTCCATCTTAAAAGCTTCTAGTCTAGTGAGAAGCCCAAATTCAATTACTTGTTCA
JMSF018L23+ GCAGATTCCATCTTAAAAGCTTNTAGTCTAGTGAGAAGCCCAAATTCAATTACTTGTTCA
JMFF002H23+ GCAGATTCCATCTTAAAAGCTTCTAGTCTAGTGAGAAGCCCAAATTCAATTACTTGTTCA
                      ____________________________________________________________
consensus GCAGATTCCATCTTAAAAGCTTCTAGTCTAGTGAGAAGCCCAAATTCAATTACTTGTTCA
 
. : . : . : . : . : . :
JMFS166F05+ CAGTAGTATCACTTAGCTAGAACCTCCTGATCTTAAAGCTCACAGAAGAGAGGTGAAGAG
JMSF040I11+ CAGTAGTATCACTTAGCTAGAACCTCCTGATCTTAAAGCTCACAGAAGAGAGGTGAAGAG
JMFF021L10+ CAGTAGTATCACTTAGCTAGAACCTCCTGATCTTAAAGCTCACAGAAGAGAGGTGAAGAG
JMFF039N23+ CAGTAGTATCACNTAGNTAGAACCTCNTGATCTTAAAGCTCACAGAAGAGAGGTGAAGAG
JMFS152G08+ CAGTAGTATCACTTAGCTAGAACCTCCTGATCTTAAAGCTCACAGAAGAGAGGTGAAGAG
JMSF009B22+ CAGTAGTATCACTTAGCTAGAACCTCCTGATCTTAAAGCTCACAGAAGAGAGGTGAAGAG
JMSF018L23+ CNGTAGTATCACTTAGCTAGAACCTCCTGATCNTAAAGCTCACAGAAGAGAGGTGAAGAG
JMFF002H23+ CAGTAGTATCACTTAGCTAGAACCTCCTGATCTTAAAGCTCACAGAAGAGAGGTGAAGAG
                      ____________________________________________________________
consensus CAGTAGTATCACTTAGCTAGAACCTCCTGATCTTAAAGCTCACAGAAGAGAGGTGAAGAG
 
. : . : . : . : . : . :
JMFS166F05+ CGA
JMSF040I11+ CGAAGAAGCTGGAAGAGTGATACACCGTTCAG
JMFF021L10+ CGAAGAAGCTGGAAGAGTGATACACCGTTCAGT
JMFF039N23+ CGAAGAAGCTGGAAGAGTGATACACCGTTCAGTAGGGAAGCCAATAATAATAATAGGC
JMFS152G08+ CGAAGAAGCTGGAAGAGTGATACACCGTTCAGTAGGGAAGCCAATAATAATAATAGGCGA
JMSF009B22+ CGAAGAGGCTGGAAGAGTGATACACCGTTCAGT
JMSF018L23+ CGAAGAAGCTGGAAGAGTGATA
JMFF002H23+ CGAAGAAGCTGGAAGAGTGATACACCGTTCAGTAGGGAAGCCAATAATAATAATAGGCGA
                      ____________________________________________________________
consensus CGAAGAAGCTGGAAGAGTGATACACCGTTCAGTAGGGAAGCCAATAATAATAATAGGCGA
 
. : . : . : . : . : . :
JMFS152G08+ ATAAAATTAGTAGAATCTCCAGAAGGAAATGAAAACACAATAGGAAA
JMFF002H23+ ATAAAATTAGTAGAATCTCCAGAAGGAAATGAAAACACAATAGGAAACGGACAGTAGAAC
                      ____________________________________________________________
consensus ATAAAATTAGTAGAATCTCCAGAAGGAAATGAAAACACAATAGGAAACGGACAGTAGAAC