Previous Contig 000085:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H06Sequence553000085 (2)gb:AY088311_15733312e-49Arabidopsis thaliana clone 5504 mRNA, complete sequence.655009972 (5)pir|F84823|F848237e-37probable peroxisomal membrane carrier protein [imported] - Arabidopsis thaliana>
JMFF007P11Sequence601000085 (2)gb:AY088311_15733316e-53Arabidopsis thaliana clone 5504 mRNA, complete sequence.719009972 (5)pir|F84823|F848238e-62probable peroxisomal membrane carrier protein [imported] - Arabidopsis thaliana>

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007P11+ CAAAAGGAGGAGGTTCAACTGNTGCAAGAAT
                      ____________________________________________________________
consensus CAAAAGGAGGAGGTTCAACTGNTGCAAGAAT
 
. : . : . : . : . : . :
JMFF007P11+ CGCATCCTNTGCTGTCATAGCTCCAGTTGGACTATTTTTGGCCTTTTTTGAATGAGTCTG
JMFF002H06+ TTGAATGAGTCTG
                      ____________________________________________________________
consensus CGCATCCTNTGCTGTCATAGCTCCAGTTGGACTATTTTTGGCCTTTTTTGAATGAGTCTG
 
. : . : . : . : . : . :
JMFF007P11+ CATGCGAGTGACAACTACCCAAATTGGATTAGTCAGCAGCACATTAACACACCCAGATAG
JMFF002H06+ CATGCGAGTGACACCTACCCAAATTGGATTAGTCAGCAGCACATTAACACACCCAGATAG
                      ____________________________________________________________
consensus CATGCGAGTGACACCTACCCAAATTGGATTAGTCAGCAGCACATTAACACACCCAGATAG
 
. : . : . : . : . : . :
JMFF007P11+ AGCAGCAACCACAAGTGATGATAACATTCCAACTGAACCATCACCAATCCCTCTCCTCTT
JMFF002H06+ AGCAGCAACCACAAGTGATGATAACATTCCAACTGAACCATCACCAATCCCTCTCCTCTT
                      ____________________________________________________________
consensus AGCAGCAACCACAAGTGATGATAACATTCCAACTGAACCATCACCAATCCCTCTCCTCTT
 
. : . : . : . : . : . :
JMFF007P11+ ACGATCAAGGGCAGCAACTTCAGCTTTGGTCCTGAATATTTGATAGAAGTAGTAATAGAC
JMFF002H06+ ACGATCAAGGGCAGCAACTTCAGCTTTGGTCCTGAATATTTGATAGAAGTAGTAATAGAC
                      ____________________________________________________________
consensus ACGATCAAGGGCAGCAACTTCAGCTTTGGTCCTGAATATTTGATAGAAGTAGTAATAGAC
 
. : . : . : . : . : . :
JMFF007P11+ ACCTTGAGAAGCCGCCGTTCCCACCAGCGACGGCGCCAAACCGCCGTAGAGCCGATCCCA
JMFF002H06+ ACCCTGAGAAGCCGCCGTTCCCACCAGCGACGGCGCCAAACCGCCGTAGAGCCGATCCCA
                      ____________________________________________________________
consensus ACCTTGAGAAGCCGCCGTTCCCACCAGCGACGGCGCCAAACCGCCGTAGAGCCGATCCCA
 
. : . : . : . : . : . :
JMFF007P11+ CCCCTCCTGCCTCGCAACCTGGCACATATGCTCAATAGTGCTAAGCTGCTTCCTCTTCCC
JMFF002H06+ CCCCTCCTGCCTCGCAACCTGGCACATATGCTCAATAGTGCTAAGCTGCTTCCTCTTCCC
                      ____________________________________________________________
consensus CCCCTCCTGCCTCGCAACCTGGCACATATGCTCAATAGTGCTAAGCTGCTTCCTCTTCCC
 
. : . : . : . : . : . :
JMFF007P11+ CTCCTTCGATTCTCGTTGCGTTTGTTGCCGCGTATTTACGGTTTGGAGCGGATAGGTGAT
JMFF002H06+ CTCCTTCGATTCTCGTTGCGTTTGTTGCCGCGTATTTACGGTTTGGAGCGGATAGGTGAT
                      ____________________________________________________________
consensus CTCCTTCGATTCTCGTTGCGTTTGTTGCCGCGTATTTACGGTTTGGAGCGGATAGGTGAT
 
. : . : . : . : . : . :
JMFF007P11+ GAGCTGAGCGATGATGCCGCCACCGGCGCCGGCGAGGCCATTGATCAAAGCATCGGACAT
JMFF002H06+ GAGCTGAGCGATGATGCCGCCACCGGCGCCGGCGAGGCCATTGATCAAAGCATCGGACAT
                      ____________________________________________________________
consensus GAGCTGAGCGATGATGCCGCCACCGGCGCCGGCGAGGCCATTGATCAAAGCATCGGACAT
 
. : . : . : . : . : . :
JMFF007P11+ AGTTACTCGGGAGCAGGAAAAGATCTGAAGAGTAATAAATTGGGCGTTGCGAGATGGTGG
JMFF002H06+ AGTTACTCGGGAGCAGGAAAAGATCTGAAGAGTAATAAATTGGGCGTTGCGAGATGGTGG
                      ____________________________________________________________
consensus AGTTACTCGGGAGCAGGAAAAGATCTGAAGAGTAATAAATTGGGCGTTGCGAGATGGTGG
 
. : . : . : . : . : . :
JMFF007P11+ GAGGAGGAGACTATCTCTGACTTTGGC
JMFF002H06+ GAGGAGGAGACTATCTCTGACTTTGGCTGTAGTAATTGAATGAAGGAAGGCATGTGAAGT
                      ____________________________________________________________
consensus GAGGAGGAGACTATCTCTGACTTTGGCTGTAGTAATTGAATGAAGGAAGGCATGTGAAGT