Previous Contig 000082:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002G02Sequence638000082 (8)pir|E84578|E845782e-55probable senescence-associated protein 5 [imported] - Arabidopsis thaliana>gb:AC743000082 (8)pir|E84578|E845784e-78probable senescence-associated protein 5 [imported] - Arabidopsis thaliana>gb:AC
JMFN008I07Sequence626000082 (8)pir|E84578|E845785e-67probable senescence-associated protein 5 [imported] - Arabidopsis thaliana>gb:AC
JMFN019K05Sequence499000082 (8)pir|E84578|E845782e-40probable senescence-associated protein 5 [imported] - Arabidopsis thaliana>gb:AC
JMSF014N09Sequence466000082 (8)pir|E84578|E845781e-39probable senescence-associated protein 5 [imported] - Arabidopsis thaliana>gb:AC421000082 (8)pir|E84578|E845786e-32probable senescence-associated protein 5 [imported] - Arabidopsis thaliana>gb:AC
JMSF052N10Sequence642000082 (8)pir|E84578|E845788e-68probable senescence-associated protein 5 [imported] - Arabidopsis thaliana>gb:AC841000082 (8)pir|E84578|E845782e-97probable senescence-associated protein 5 [imported] - Arabidopsis thaliana>gb:AC

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN019K05+ AATTAACTAAACACTCATATTTTCTCTTGTTTTAGGTTTAT
rJMFF002G02- CTCATATTTTCTCTTGTTTTAGGTTTAT
                      ____________________________________________________________
consensus AATTAACTAAACACTCATATTTTCTCTTGTTTTAGGTTTAT
 
. : . : . : . : . : . :
JMFN019K05+ AAATTATAACCCATTTGATTTAGCTACAATACAATACAATGATACAAAAACTAGAAGAAT
rJMFF002G02- AAATTATAACCCATTTGATTTAGCTACAATACAATACAATGATACAAAAACTAGAAGAAT
                      ____________________________________________________________
consensus AAATTATAACCCATTTGATTTAGCTACAATACAATACAATGATACAAAAACTAGAAGAAT
 
. : . : . : . : . : . :
JMFN019K05+ ATATACAAGATGGAAATCAATAAAGAAAAGCGCATCAAACTAAAGCATGCAAGAAAAGCT
rJMSF014N09- AGCGCATCATACTANAGCATGCANGAAAAGCT
rJMFF002G02- ATATACAAGATGGAAATCAATAAAGAAAAGCGCATCAAACTAAAGCATGCAAGAAAAGCT
rJMSF052N10- AGATGGAAATCAATAAAGAAAAGCGCATCAAACTAAAGCATGCAAGAAAAGCT
                      ____________________________________________________________
consensus ATATACAAGATGGAAATCAATAAAGAAAAGCGCATCAAACTAAAGCATGCAAGAAAAGCT
 
. : . : . : . : . : . :
JMFN019K05+ AAACCAAAAGCCCAAAACAACATA-GTTCCAAATTAATCCTGCAGCTTTGGGAATCGATC
rJMSF014N09- AAACCANNAGCCCAAAACAACATATGTTCCAAATTAATCCTGCAGCTTTGGGAATCGATC
rJMFF002G02- AAACCAAATGCCCAAAACAACATA-GTTCCAAATTAATCCTGCAGCTTTGGGAATCGATC
rJMSF052N10- AAACCAAAAGCCCAAAACAACATA-GTTCCAAATTAATCCTGCAGCTTTGGGAATCGATC
                      ____________________________________________________________
consensus AAACCAAAAGCCCAAAACAACATA-GTTCCAAATTAATCCTGCAGCTTTGGGAATCGATC
 
. : . : . : . : . : . :
JMFN019K05+ AAATCAAGTCGTCATACCCAGCCTTGCTTGTACCTGCGGAAAAGTTCTTCAGTTTGGGCA
rJMSF014N09- AAATCAAGTCGTCATACCCAGCCTTGNTTGTACCTGCGGAAAAGTTCTTCAGTTTGGGCA
rJMFF002G02- AAATCAAGTCGTCATACCCAGCCTTGCTTGTACCTGCGGAAAAGTTCTTCAGTTTGGGCA
rJMSF052N10- AAATCAAGTCGTCATACCCAGCCTCGCTTGTACCTGCGGAAAAGTTCTTCAGTTTGGGCA
                      ____________________________________________________________
consensus AAATCAAGTCGTCATACCCAGCCTTGCTTGTACCTGCGGAAAAGTTCTTCAGTTTGGGCA
 
. : . : . : . : . : . :
JMFN019K05+ TTCTTGTATGCGCTGCAAGCGATGAGATAAACCCAAATCAGAACCACCACCGTGATGATC
rJMSF014N09- TTCTTGTATGCGCTGCNNGCGATGAGATAAACCCAAATCAGAACCACCACCGTGATGATC
rJMFF002G02- TTCTTGTATGCGCTGCAAGCGATGAGATAAACCCAAATCAGAACCACCACCGTGATGATC
rJMSF052N10- TTCTTGTATGCGCTGCAAGCGATGAGATAAACCCAAATCAGAACCACCACCGTGATGATC
                      ____________________________________________________________
consensus TTCTTGTATGCGCTGCAAGCGATGAGATAAACCCAAATCAGAACCACCACCGTGATGATC
 
. : . : . : . : . : . :
JMFN019K05+ ATGATCAGGTTGGCTTTCCTCCATTCCCTTCTCAGGTTTCCCAGCAGACCGGCCTTGCAT
rJMSF014N09- ATGATCAGGTNGGCTTTCCTCCATTCCCTTCTCAGGNTTCCCANCANACCGGNCTTGCAT
rJMFF002G02- ATGATCAGGTTGGCTTTCCTCCATTCCCTTCTCAGGTTTCCCAGCAGACCGGCCTTGCAT
rJMSF052N10- ATGATCAGGTTGGCTTTCCTCCATTCCCTTCTCAGGTTTCCCAGCAGACCGGCCTTGCAT
                      ____________________________________________________________
consensus ATGATCAGGTTGGCTTTCCTCCATTCCCTTCTCAGGTTTCCCAGCAGACCGGCCTTGCAT
 
. : . : . : . : . : . :
JMFN019K05+ GAATCGCAGCTGTAGCAGAGTTGACTGGGGTCGTTGTTCCACACAGAACAGTCGCCGTCT
rJMSF014N09- GAATCGCANCTGTAGCANAGTTGACTGGGGTCGTTGTTCCACNCNGAACAGTCGCCGTCT
rJMFF002G02- GAATCGCAGCTGTAGCAGAGTTGACTGGGGTCGTTGTTCCACACAGAACAGTCGCCGTCT
rJMSF052N10- GAATCGCAGCTGTAGCAGAGTTGACTGGGGTCGTTGTTCCACACAGAACAGTCGCCGTCT
                      ____________________________________________________________
consensus GAATCGCAGCTGTAGCAGAGTTGACTGGGGTCGTTGTTCCACACAGAACAGTCGCCGTCT
 
. : . : . : . : . : . :
JMFN019K05+ GCGGCGGCGTTGGTCGGGTTTATCCAC
rJMSF014N09- GCGGCGGCGTTGGTCGGGTTTATCCACNCCGNCGGNTTCNAATACTGGTAGCCGCATATC
rJMFF002G02- GCGGCGGCGTTGGTCGGGTTTATCCACACCGTCGGGTTCGAATACTGGTAGCCGCATATC
rJMSF052N10- GCGGCGGCGTTGGTCGGGTTTATCCACACCGTCGGGTTCGAATACTGGTAGCCGCATATC
JMFN008I07+ GCGGCGTTGGTCGGGTTTATCCACACCGTCGGGTTCGAATACTGGTAGCCGCATATC
JMSF052N10+ TTATCCACACCGTCGGGTTCGAATACTGGTAGCCGCATATC
                      ____________________________________________________________
consensus GCGGCGGCGTTGGTCGGGTTTATCCACACCGTCGGGTTCGAATACTGGTAGCCGCATATC
 
. : . : . : . : . : . :
rJMSF014N09- GTCGGANGCTTGCANCAACCGGACTGAA
rJMFF002G02- GTCGGAGGCTTGCAGCAACCGGACTGAAGAGGAGAGAGATGAGCGGCGAAGAATTGCTCA
rJMSF052N10- GTCGGAGGCTTGCAGCAACCGGACTGAAGAGGAGAGAGATGAGCGGCGAAGAATTGCTCA
JMFN008I07+ GTCGGAGGCTTGCAGCAACCGGACTGAAGAGGAGAGAGATGAGCGGCGAAGAATTGCTCA
JMSF052N10+ GTCGGAGGCTTGCAGCAACCGGACTGAAGAGGAGAGAGATGAGCGGCGAAGAATTGCTCA
JMFF002G02+ ACTGAAGAGGAGAGAGATGAGCGGCGAAGAATTGCTCA
                      ____________________________________________________________
consensus GTCGGAGGCTTGCAGCAACCGGACTGAAGAGGAGAGAGATGAGCGGCGAAGAATTGCTCA
 
. : . : . : . : . : . :
rJMFF002G02- GCAGTGAAAAACTCGTTATTAAGCTTGGGGCAAATATCGCCGTCAGCCAAACACGCCCTT
rJMSF052N10- GCAGTGAAAAACTCGTTATTAAGCTTGGGGCAAATATCGCCGTCAGCCAAACACGCCCTT
JMFN008I07+ GCAGTGAAAAACTCGTTATTAAGCTTGGGGCAAATATCGCCGTCAGCCAAACACGCCCTT
JMSF052N10+ GCAGTGAAAAACTCGTTATTAAGCTTGGGGCAAATATCGCCGTCAGCCAAACACGCCCTT
JMFF002G02+ GCAGTGAAAAACTCGTTATTAAGCTTGGGGCAAATATCGCCGTCAGCCAAACACGCCCTT
                      ____________________________________________________________
consensus GCAGTGAAAAACTCGTTATTAAGCTTGGGGCAAATATCGCCGTCAGCCAAACACGCCCTT
 
. : . : . : . : . : . :
rJMFF002G02- ATCTTCCCCCAACTATCCGAACTCGTGATGTGGTTTCTCAGCCAAGACGAGTACCCTCCC
rJMSF052N10- ATCTTCCCCCAACTATCCGAACTCGTGATGTGGTTTCTCAGCCAAGACGAGTACCCTCCC
JMFN008I07+ ATCTTCCCCCAACTATCCGAACTCGTGATGTGGTTTCTCAGCCAAGACGAGTACCCTCCC
JMSF052N10+ ATCTTCCCCCAACTATCCGAACTCGTGATGTGGTTTCTCAGCCAAGACGAGTACCCTCCC
JMSF014N09+ TCCGAACTCGTGATGTGGTTTCTCAGCCAAGACGAGTACCNTCCC
JMFF002G02+ ATCTTCCCCCAACTATCCGAACTCGTGATGTGGTTTCTCAGCCAAGACGAGTACCCTCCC
                      ____________________________________________________________
consensus ATCTTCCCCCAACTATCCGAACTCGTGATGTGGTTTCTCAGCCAAGACGAGTACCCTCCC
 
. : . : . : . : . : . :
rJMFF002G02- AGCCGGTACTCGTCGTAGCCCCGTCCGGGTACGCTGTACGCGCCGCTGGGGCGAGT
rJMSF052N10- AGCCGGTACTCGTCGTAGCCCCGTCCGGGTACGCTGTACGCGCCGCTGGGGCGAGTGACG
JMFN008I07+ AGCCGGTACTC-TCGTAGCCCCGTCCGGGTACGCTGTACGCGCCGCTGGGGCGAGTGACG
JMSF052N10+ AGCCGGTACTCGTCGTAGCCCCGTCCGGGTACGCTGTACGCGCCGCTGGGGCGAGTGACG
JMSF014N09+ AGCCGGTACTCGTCGTAGCCCCGTCCGGGTACGCTGTACGCGCCGCTGGGGCGAGTGACG
JMFF002G02+ AGCCGGTACTCGTCGTAGCCCCGTCCGGGTACGCTGTACGCGCCGCTGGGGCGAGTGACG
                      ____________________________________________________________
consensus AGCCGGTACTCGTCGTAGCCCCGTCCGGGTACGCTGTACGCGCCGCTGGGGCGAGTGACG
 
. : . : . : . : . : . :
rJMSF052N10- ACGAAGGCCAGGATCAGGAGAGAGAGCAGGAGGATGATGAGTATAGCCATACAGACGAGG
JMFN008I07+ ACGAAGGCCAGGATCAGGAGAGAGAGCAGGAGGATGATGAGTATAGCCATACAGACGAGG
JMSF052N10+ ACGAAGGCCAGGATCAGGAGAGAGAGCAGGAGGATGATGAGTATAGCCATACAGACGAGG
JMSF014N09+ ACGAAGGCCAGGATCAGGAGAGAGAGCAGGAGGATGATGAGTATAGCCATACAGACGAGG
JMFF002G02+ ACGAAGGCCAGGATCAGGAGAGAGAGCAGGAGGATGATGAGTATAGCCATACAGACGAGG
                      ____________________________________________________________
consensus ACGAAGGCCAGGATCAGGAGAGAGAGCAGGAGGATGATGAGTATAGCCATACAGACGAGG
 
. : . : . : . : . : . :
rJMSF052N10- TAGAGGCCGAGGAGGCCCTCCTTCTTCCAGTACGCGCCGGCGAAGCCGGCGAGTGAGACC
JMFN008I07+ TAGAGGCCGAGGAGGCCCTCCTTCTTCCAGTACGCGCCGGCGAAGCCGGCGAGTGAGACC
JMSF052N10+ TAGAGGCCGAGGAGGCCCTCCTTCTTCCAGTACGCGCCGGCGAAGCCGGCGAGTGAGACC
JMSF014N09+ TAGAGGCCGAGGAGGCCCTCCTTCTTCCAGTACGCGCCGGCGAAGCCGGCGAGTGAGACC
JMFF002G02+ TAGAGGCCGAGGAGGCCCTCCTTCTTCCAGTACGCGCCGGCGAAGCCGGCGAGTGAGACC
                      ____________________________________________________________
consensus TAGAGGCCGAGGAGGCCCTCCTTCTTCCAGTACGCGCCGGCGAAGCCGGCGAGTGAGACC
 
. : . : . : . : . : . :
rJMSF052N10- AGCATGATGGCGATTCCGATGAAGACAACCGGCCACCGGAGCCAGTGGATGCACTCGTTG
JMFN008I07+ AGCATGATGGCGATTCCGATGAAGACAACCGGCCACCGGAGCCAGTGGATGCACTCGTTG
JMSF052N10+ AGCATGATGGCGATTCCGATGAAGACAACCGGCCACCGGAGCCAGTGGATGCACTCGTTG
JMSF014N09+ AGCATGATGGCGATTCCGATGAAGACAACCGGCCACCGGAGCCAGTGGATGCACTCGTTG
JMFF002G02+ AGCATGATGGCGATTCCGATGAAGACAACCGGCCACCGGAGCCAGTGGATGCACTCGTTG
                      ____________________________________________________________
consensus AGCATGATGGCGATTCCGATGAAGACAACCGGCCACCGGAGCCAGTGGATGCACTCGTTG
 
. : . : . : . : . : . :
rJMSF052N10- TCGGGCTTG
JMFN008I07+ TCGGGCTTGGAGGCGAGCCAGATTCCGGCGGCGGTGATGGGGATGGAACACATGAAGGCC
JMSF052N10+ TCGGGCTTGGAGGCGAGCCAGATTCCGGCGGCGGTGATGGGGATGGAACACATGAAGGCC
JMSF014N09+ TCGGGCTTGGAGGCGAGCCAGATTCCGGCGGCGGTGATGGGGATGGAACACATGAAGGCC
JMFF002G02+ TCGGGCTTGGAGGCGAGCCAGATTCCGGCGGCGGTGATGGGGATGGAACACATGAAGGCC
                      ____________________________________________________________
consensus TCGGGCTTGGAGGCGAGCCAGATTCCGGCGGCGGTGATGGGGATGGAACACATGAAGGCC
 
. : . : . : . : . : . :
JMFN008I07+ AGGAAATTGAGGAAAGCTGTGATGTTGTTGCTTAACGACATGGTGGCCGGCGGCGGTGTT
JMSF052N10+ AGGAAATTGAGGAAAGCTGTGATGTTGTTGCTTAACGACATGGTGGCCGGCGGCGGTGTT
JMSF014N09+ AGGAAATTGAGGAAAGCTGTGATGTTGTTGCTTAACGACATGGTGGCCGGCGGCGGTGTT
JMFF002G02+ AGGAAATTGAGGAAAGCTGTGATGTTGTTGCTTAACGACATGGTGGCCGGCGGCGGTGTT
                      ____________________________________________________________
consensus AGGAAATTGAGGAAAGCTGTGATGTTGTTGCTTAACGACATGGTGGCCGGCGGCGGTGTT
 
. : . : . : . : . : . :
JMFN008I07+ GCGGTGGTGAGCGGTGGTGAGTTAAGTAGT
JMSF052N10+ GCGGTGGTGAGCGGTGGTGAGTTAAGTAGTTCGTAGTGGTTTGGGAAAAGGAAGAAGAA
JMSF014N09+ GCGGTGGTGAGCGGTGGTGAGTTAAGTAGTTCGTAGTGGTTTGGGAAAAGGAAGAAGAA
JMFF002G02+ GCGGTGGTGAGCGGTGGTGAGTTAAGTAGTTCGTAGTGGTTTGGGAAAAGGAAGAAGAAC
                      ____________________________________________________________
consensus GCGGTGGTGAGCGGTGGTGAGTTAAGTAGTTCGTAGTGGTTTGGGAAAAGGAAGAAGAAC
 
. : . : . : . : . : . :
JMFF002G02+ GATGTGGAGACACGCGCAGTACTACTTATAGAAAATGATAGATTACGAGATAAGAATGGC
                      ____________________________________________________________
consensus GATGTGGAGACACGCGCAGTACTACTTATAGAAAATGATAGATTACGAGATAAGAATGGC