Previous Contig 000081:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002G01Sequence387000081 (19)gb:CSU56820_16741331e-17Calystegia sepium lectin mRNA, complete cds.635000081 (19)gb:AF233284_17794343e-39Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFF008A16Sequence609000081 (19)gb:AF233284_17794348e-40Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.729000081 (19)gb:AF233284_17794341e-39Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFF014K03Sequence595000081 (19)gb:AF233284_17794348e-40Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.712000081 (19)gb:AF233284_17794341e-39Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFF022O10Sequence462000081 (19)gb:AF233284_17794341e-25Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.681000081 (19)gb:AF233284_17794341e-39Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFF038A24Sequence581000081 (19)gb:AF233284_17794348e-35Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.750000081 (19)gb:AF233284_17794341e-39Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFF051K12Sequence615000081 (19)gb:AF233284_17794348e-40Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.523000081 (19)gb:AF233284_17794344e-25Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFN006O09Sequence627000081 (19)gb:AF233284_17794349e-40Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFN010I23Sequence627000081 (19)gb:AF233284_17794349e-40Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFN031P05Sequence633000081 (19)gb:AF233284_17794349e-40Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFN033G19Sequence651000081 (19)gb:AF233284_17794349e-40Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFN034H05Sequence624000081 (19)gb:AF233284_17794349e-40Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFN034L23Sequence639000081 (19)gb:AF233284_17794342e-39Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.
JMFN038M13Sequence633000081 (19)gb:AF233284_17794341e-38Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008A16- TTATTATACACCTAATAATAGGCGCAACAT
rJMFF014K03- ACAT
rJMFF051K12- ATTATTATACACCTAATAATAGGCGCAACAT
rJMFF038A24- GGATATTATTATACACCTAATAATAGGCGCAACAT
                      ____________________________________________________________
consensus GGATATTATTATACACCTAATAATAGGCGCAACAT
 
. : . : . : . : . : . :
rJMFF008A16- TATTTATTAATATGCTCACACACATGAGAGAATATTTGAGAAACATAAAACATGGACCGC
JMFN033G19+ CATAAAACATGGACCGC
JMFN034L23+ ACATAAAACATGGACCGC
JMFN031P05+ GC
rJMFF014K03- TATTTATTAATATGCTCACACACATGAGAGAATATTTGAGAAACATAAAACATGGACCGC
rJMFF051K12- TATTTATTAATATGCTCACACACATGAGAGAATATTTGAGAAACATAAAACATGGACCGC
rJMFF038A24- TATTTATTAATATGCTCACACACATGAGAGAATATTTGAGAAAAATAAAACATGGACCGC
rJMFF022O10- GAATATTTGAGAAACATAAAACATGGACCGC
                      ____________________________________________________________
consensus TATTTATTAATATGCTCACACACATGAGAGAATATTTGAGAAACATAAAACATGGACCGC
 
. : . : . : . : . : . :
rJMFF008A16- TCAGTACAACGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
JMFN038M13+ CAGTACAACGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
JMFN034H05+ CGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
JMFN033G19+ TCAGTACAACGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
JMFN034L23+ TCAGTACAACGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
JMFN010I23+ GTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
JMFN006O09+ TACAACGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
JMFN031P05+ TCAGTACAACGTTATCAAGTCATNTGGAA-TTATTCAACGTAACATATTACAACCGAAAC
rJMFF014K03- TCAGTACAACGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
JMFF014K03+ CCGAAAC
rJMFF051K12- TCAGTACAACGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
rJMFF038A24- TCAGTACAACGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
rJMFF022O10- TCAGTACAACGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
JMFF051K12+ AACGTAACATATTACAACCGAAAC
JMFF008A16+ ACATATTACAACNGAAAC
rJMFF002G01- TTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
                      ____________________________________________________________
consensus TCAGTACAACGTTATCAAGTCATTTGGAACTTATTCAACGTAACATATTACAACCGAAAC
 
. : . : . : . : . : . :
rJMFF008A16- AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFN038M13+ AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFN034H05+ AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFN033G19+ AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFN034L23+ AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFN010I23+ AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFN006O09+ AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFN031P05+ AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
rJMFF014K03- AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFF014K03+ AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFF038A24+ CCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
rJMFF051K12- AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
rJMFF038A24- AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
rJMFF022O10- AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFF051K12+ AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
JMFF008A16+ ATAAAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
rJMFF002G01- AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
                      ____________________________________________________________
consensus AT-AAAGGTGTTCCAATGGAGCATTAAGCTTCAGAGCTGAGTAACGATATAATCACTTAA
 
. : . : . : . : . : . :
rJMFF008A16- GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFN038M13+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFN034H05+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFN033G19+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFN034L23+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFN010I23+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFN006O09+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFN031P05+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
rJMFF014K03- GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFF014K03+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFF038A24+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
rJMFF051K12- GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
rJMFF038A24- GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
rJMFF022O10- GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFF051K12+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
JMFF008A16+ GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
rJMFF002G01- GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
                      ____________________________________________________________
consensus GCATTATAAGTACCAATAGCATCAACATAGAATCCAGCTCGCCCAAAGAATCCAACAATC
 
. : . : . : . : . : . :
rJMFF008A16- TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFN038M13+ TTGGCGACATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFN034H05+ TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFN033G19+ TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFN034L23+ TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFN010I23+ TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFN006O09+ TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFN031P05+ TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
rJMFF014K03- TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFF014K03+ TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFF038A24+ TNGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
rJMFF051K12- TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
rJMFF038A24- TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
rJMFF022O10- TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFF051K12+ TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFF008A16+ TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
JMFF022O10+ TGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
rJMFF002G01- TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
                      ____________________________________________________________
consensus TTGGCGCCATCCTGAGCCTGGAAGTTGAACGGCGTTCCAACATTGGGGCCGTATGGCCCA
 
. : . : . : . : . : . :
rJMFF008A16- AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFN038M13+ AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFN034H05+ AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFN033G19+ AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFN034L23+ AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFN010I23+ AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFN006O09+ AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFN031P05+ AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
rJMFF014K03- AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFF014K03+ AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFF038A24+ AACGCTTCTTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
rJMFF051K12- AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
rJMFF038A24- AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
rJMFF022O10- AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFF051K12+ AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFF008A16+ AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFF022O10+ AACGCTCTTTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
rJMFF002G01- AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
JMFF002G01+ ATCGTAACACATCGAACCTNGTATCTAT
                      ____________________________________________________________
consensus AACGCTC-TTACGTTGGTAGTAAACTTTACAGATCGTAACACATCGAACCTCGTATCTAT
 
. : . : . : . : . : . :
rJMFF008A16- GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFN038M13+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFN034H05+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFN033G19+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFN034L23+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFN010I23+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFN006O09+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFN031P05+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
rJMFF014K03- GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFF014K03+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFF038A24+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
rJMFF051K12- GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
rJMFF038A24- GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
rJMFF022O10- GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFF051K12+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFF008A16+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFF022O10+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
rJMFF002G01- GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
JMFF002G01+ GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
                      ____________________________________________________________
consensus GAAACGTCCAAACGCTCCGCTTATCTCGGTCAGGTATTCATCCGCGCCATCAATATTAAT
 
. : . : . : . : . : . :
rJMFF008A16- CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFN038M13+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFN034H05+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFN033G19+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFN034L23+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGCAATCCTT
JMFN010I23+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFN006O09+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFN031P05+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
rJMFF014K03- CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFF014K03+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFF038A24+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
rJMFF051K12- CGTGTCGTTACGGATGACGGTCGTTTCATT-CCACCTCCACCAATTGTGAGGGAATCCTT
rJMFF038A24- CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
rJMFF022O10- CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFF051K12+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFF008A16+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
JMFF022O10+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
rJMFF002G01- CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGCGAGGGAATCCTT
JMFF002G01+ CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGCGAGGGAATCCTT
                      ____________________________________________________________
consensus CGTGTCGTTACGGATGACGGTCGTTTCATTCCCACCTCCACCAATTGTGAGGGAATCCTT
 
. : . : . : . : . : . :
rJMFF008A16- TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFN038M13+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFN034H05+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFN033G19+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFN034L23+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFN010I23+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFN006O09+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFN031P05+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
rJMFF014K03- TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFF014K03+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFF038A24+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
rJMFF051K12- TGAACCATCCTTATT
rJMFF038A24- TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
rJMFF022O10- TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFF051K12+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFF008A16+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFF022O10+ TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
rJMFF002G01- TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
JMFF002G01+ TGANCCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
                      ____________________________________________________________
consensus TGAACCATCCTTATTAGTTGAAGAAAAAGTTATACCAATGGGATTATTATTTCCGGACCC
 
. : . : . : . : . : . :
rJMFF008A16- ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFN038M13+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFN034H05+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFN033G19+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFN034L23+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFN010I23+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFN006O09+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFN031P05+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
rJMFF014K03- ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFF014K03+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFF038A24+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
rJMFF038A24- ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
rJMFF022O10- ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFF051K12+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFF008A16+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFF022O10+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
rJMFF002G01- ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
JMFF002G01+ ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
                      ____________________________________________________________
consensus ACCAGATAAAATAATAATTTGATCGATCTTGTTCATAGGTCGGAAACTCCAAAAGTCACC
 
. : . : . : . : . : . :
rJMFF008A16- ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTATTTGAA
JMFN038M13+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFN034H05+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFN033G19+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFN034L23+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFN010I23+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFN006O09+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFN031P05+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
rJMFF014K03- ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFF014K03+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFF038A24+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
rJMFF038A24- ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
rJMFF022O10- ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFF051K12+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFF008A16+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFF022O10+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
rJMFF002G01- ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
JMFF002G01+ ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
                      ____________________________________________________________
consensus ACCGTTGTGTCCCAATGGACCATATGCGACATCGGTAGAAATTGCCATTGTTTA-TTGAA
 
. : . : . : . : . : . :
rJMFF008A16- TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAG
JMFN038M13+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAA
JMFN034H05+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAA
JMFN033G19+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAA
JMFN034L23+ TGAAAATTGAAAAGCAAATTAAAA
JMFN010I23+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGA
JMFN006O09+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGA
JMFN031P05+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAA
rJMFF014K03- TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGT
JMFF014K03+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGT
JMFF038A24+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGT
rJMFF038A24- TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGT
rJMFF022O10- TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGTGT
JMFF051K12+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGTGT
JMFF008A16+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGTGT
JMFF022O10+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGTGT
rJMFF002G01- TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGTGT
JMFF002G01+ TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGTGTGGAGAGG
                      ____________________________________________________________
consensus TGAAAATTGAAAAGCAAATTAAAAGGGAGAATGAAAATGAGAAAGTTTGGTGTGGAGAGG