Previous Contig 000028:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001J09Sequence549000028 (17)sp|Q40089|ATP4_IPOBA3e-76ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41630000028 (17)sp|Q40089|ATP4_IPOBA1e-70ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMFF016N05Sequence556000028 (17)sp|Q40089|ATP4_IPOBA3e-77ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41623000028 (17)sp|Q40089|ATP4_IPOBA2e-67ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMFF051E13Sequence595000028 (17)sp|Q40089|ATP4_IPOBA9e-84ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41551000028 (17)sp|Q40089|ATP4_IPOBA1e-50ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMFN009B12Sequence600000028 (17)sp|Q40089|ATP4_IPOBA7e-92ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMFN013O23Sequence620000028 (17)sp|Q40089|ATP4_IPOBA1e-92ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMFN032A17Sequence630000028 (17)sp|Q40089|ATP4_IPOBA3e-94ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMFN032P18Sequence594000028 (17)sp|Q40089|ATP4_IPOBA1e-92ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMFN033P16Sequence650000028 (17)sp|Q40089|ATP4_IPOBA2e-97ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMFN036M15Sequence628000028 (17)sp|Q40089|ATP4_IPOBA6e-75ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMFN046G23Sequence592000028 (17)sp|Q40089|ATP4_IPOBA4e-92ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMSF042P07Sequence780000028 (17)sp|Q40089|ATP4_IPOBAe-104ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41671000028 (17)sp|Q40089|ATP4_IPOBA2e-67ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41
JMSF043P07Sequence704000028 (17)sp|Q40089|ATP4_IPOBAe-104ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41638000028 (17)sp|Q40089|ATP4_IPOBA2e-60ATP synthase delta' chain, mitochondrial precursor (EC 3.6.3.14).>pir|A41740|A41

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043P07- AAGGTTCAAATGT
rJMSF042P07- TAAGGTTCAAATGT
                      ____________________________________________________________
consensus TAAGGTTCAAATGT
 
. : . : . : . : . : . :
rJMSF043P07- GCTAAAAGATGCCACAGTCTGACAAACAAAATTATTTCAATTTAGAAACTGTACTTGTCA
rJMFF051E13- GACAAACAAAATTATTTCAATTTAGAAACTGTACTTGTCA
rJMSF042P07- GCTAAAAGATGCCACAGTCTGACAAACAAAATTATTTCAATTTAGAAACTGTACTTGTCA
rJMFF016N05- ATTTAGAAACTGTACTTGTCA
rJMFF001J09- AACTGTACTTGTCA
                      ____________________________________________________________
consensus GCTAAAAGATGCCACAGTCTGACAAACAAAATTATTTCAATTTAGAAACTGTACTTGTCA
 
. : . : . : . : . : . :
rJMSF043P07- CGACTGCAGTTCAGGAATACAAATGANANGGTTCATAGCTAGTCCTGTANATTTATTCAA
rJMFF051E13- CGACTGCAGTTCAGGAATACAAATGAGATGGTTCATAGCTAGTCCTGTAAATTTATTCAA
rJMSF042P07- CGACTGCAGTTCAGGAATACAAATGAGATGGTTCATAGCTAGTCCTGTAAATTTATTCAA
rJMFF016N05- CGACTGCAGTTCAGGAATACAAATGAGATGGTTCATAGCTAGTCCTGTAAATTTATTCAA
rJMFF001J09- CGACTGCAGTTCAGGAATACAAATGAGATGGTTCATAGCTAGTCCTGTAAATTTATTCAA
JMFN036M15+ AGTTCAGGAATACAAATGAGATGGTTCATAGCTAGTCCTGTAAA-TTATTCAA
                      ____________________________________________________________
consensus CGACTGCAGTTCAGGAATACAAATGAGATGGTTCATAGCTAGTCCTGTAAATTTATTCAA
 
. : . : . : . : . : . :
rJMSF043P07- GTGAAGCAACATGCCTGAAATGTTCTGCATAGTTGTACAAAAGATAATCCATCGGGGACG
rJMFF051E13- GTGAAGCAACATGCCTGAAATGTTCTGCATAGTTGTACAAAAGATAATCCATCGGGGACG
rJMSF042P07- GTGAAGCAACATGCCTGAAATGTTCTGCATAGTTGTACAAAAGATAATCCATCGGGGACG
rJMFF016N05- GTGAAGCAACATGCCTGAAATGTTCTGCATAGTTGTACAAAAGATAATCCATCGGGGACG
rJMFF001J09- GTGAAGCAACATGCCTGAAATGTTCTGCATAGTTGTACAAAAGATAATCCATCGGGGACG
JMFN036M15+ GTGAAGCAACATGCCTGAAATGTTCTGCATAGTTGTACAAAAGATAATCCATCGGGGACG
JMSF042P07+ GGGGACG
                      ____________________________________________________________
consensus GTGAAGCAACATGCCTGAAATGTTCTGCATAGTTGTACAAAAGATAATCCATCGGGGACG
 
. : . : . : . : . : . :
rJMSF043P07- AGCATATGAAGATGAGTACAAAAGGAAATCTTTCGAGAAAAAATTAAGGTGGACATGAGA
rJMFF051E13- AGCATATGAAGATGAGTACAAAAGGAAATCTTTCGAGAAAAAATTAAGGTGGACATGAGA
rJMSF042P07- AGCATATGAAGATGAGTACAAAAGGAAATCTTTCGAGAAAAAATTAAGGTGGACATGAGA
rJMFF016N05- AGCATATGAAGATGAGTACAAAAGGAAATCTTTCGAGAAAAAATTAAGGTGGACATGAGA
rJMFF001J09- AGCATATGAAGATGAGTACAAAAGGAAATCTTTCGAGAAAAAATTAAGGTGGACATGAGA
JMFN036M15+ AGCATATGAAGATGAGTACAAAAGGAAATCTTTCGAGAAAAAATTAAGGTGGACATGAGA
JMSF042P07+ AGCATATGAAGATGAGTACAAAAGGAAATCTTTCGAGAAAAAATTAAGGTGGACATGAGA
                      ____________________________________________________________
consensus AGCATATGAAGATGAGTACAAAAGGAAATCTTTCGAGAAAAAATTAAGGTGGACATGAGA
 
. : . : . : . : . : . :
rJMSF043P07- ATCGCCACTAGCTTAACCAGTAAGAGCAGCGTTAAGGGCGCTGTGTACATCCACACCAAT
rJMFF051E13- ATCGCCACTAGCTTAACCAGTAAGAGCAGTGTTAAGGGCGCTGTGTACATCCACACCAAT
rJMSF042P07- ATCGCCACTAGCTTAACCAGTAAGAGCAGCGTTAAGGGCGCTGTGTACATCCACACCAAT
rJMFF016N05- ATCGCCACTAGCTTAACCAGTAAGAGCAGCGTTAAGGGCGCTGTGTACATCCACACCAAT
rJMFF001J09- ATCGCCACTAGCTTAACCAGTAAGAGCAGCGTTAAGGGCGCTGTGTACATCCACACCAAT
JMFN036M15+ ATCGCCACTAGCTTAACCAGTAAGAGCAGCGTTAAGGGCGCTGTGTACATCCACACCAAT
JMSF043P07+ AGCTTAACCAGTAAGAGCAGCGTTAAGGGCGCTGTGTACATCCACACCAAT
JMFN033P16+ GTACATCCACACCAAT
JMSF042P07+ ATCGCCACTAGCTTAACCAGTAAGAGCAGCGTTAAGGGCGCTGTGTACATCCACACCAAT
                      ____________________________________________________________
consensus ATCGCCACTAGCTTAACCAGTAAGAGCAGCGTTAAGGGCGCTGTGTACATCCACACCAAT
 
. : . : . : . : . : . :
rJMSF043P07- CTGGGCTTCGGCTTTCTCAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
rJMFF051E13- CTGGGCTTCGGCTTTCTCAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
rJMSF042P07- CTGGGCTTCGGCTTTCTCAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
rJMFF016N05- CTGGGCTTCGGCTTTCTCAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
rJMFF001J09- CTGGGCTTCGGCTTTCTCAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
JMFN036M15+ CTGGGCTTCGGCTTTCTCAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
JMSF043P07+ CTGGGCTTCGGCTTTCTCAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
JMFN033P16+ CTGGGCTTCGGCTTTCTCAATATCAGTGNAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
JMFN046G23+ TCAATATCAGTGNAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
JMFN032A17+ TTCGGCTTTCTCAATATCAGTGNAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
JMFN032P18+ CAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
JMFN013O23+ TCAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
JMFN009B12+ TCAATATCAGGTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
JMSF042P07+ CTGGGCTTCGGCTTTCTCAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
                      ____________________________________________________________
consensus CTGGGCTTCGGCTTTCTCAATATCAGTTGAAGCGGAGTTTAGCTTCTGTGTGAACTCAGC
 
. : . : . : . : . : . :
rJMSF043P07- GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
rJMFF051E13- GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
rJMSF042P07- GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
rJMFF016N05- GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
rJMFF001J09- GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMFN036M15+ GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMSF043P07+ GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMFN033P16+ GAGGCCCTTTNGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMFN046G23+ GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMFN032A17+ GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMFN032P18+ GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMFN013O23+ GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMFN009B12+ GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMFF051E13+ GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMSF042P07+ GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
JMFF016N05+ CAGCTTCAACAGCAAT
JMFF001J09+ AACAGCAAT
                      ____________________________________________________________
consensus GAGGCCCTTTTGCACAAGATTTGCATCAAATCGGTCAAGTGGCACAGCTTCAACAGCAAT
 
. : . : . : . : . : . :
rJMSF043P07- TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
rJMFF051E13- TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
rJMSF042P07- TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
rJMFF016N05- TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
rJMFF001J09- TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMFN036M15+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMSF043P07+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMFN033P16+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMFN046G23+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMFN032A17+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMFN032P18+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMFN013O23+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMFN009B12+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMFF051E13+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMSF042P07+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMFF016N05+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
JMFF001J09+ TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
                      ____________________________________________________________
consensus TATATCCGCGAAAGAATTTGCATGGATGAAAGCGAAGCCGCCACTCACAAAGTATTTATT
 
. : . : . : . : . : . :
rJMSF043P07- CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCANCAATCGTGGCCAC
rJMFF051E13- CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
rJMSF042P07- CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
rJMFF016N05- CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
rJMFF001J09- CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMFN036M15+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMSF043P07+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMFN033P16+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMFN046G23+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMFN032A17+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMFN032P18+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMFN013O23+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMFN009B12+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMFF051E13+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMSF042P07+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMFF016N05+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
JMFF001J09+ CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
                      ____________________________________________________________
consensus CACGTCATTACCTTCGTGAACTGACATGACACCAGGCTTCAGCTCAGCAATCGTGGCCAC
 
. : . : . : . : . : . :
rJMSF043P07- ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
rJMFF051E13- ATGGCCAGGTAGAACACCCATCTGTCCTGT
rJMSF042P07- ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
rJMFF016N05- ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
rJMFF001J09- ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMFN036M15+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMSF043P07+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMFN033P16+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMFN046G23+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMFN032A17+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMFN032P18+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMFN013O23+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMFN009B12+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMFF051E13+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMSF042P07+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMFF016N05+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
JMFF001J09+ ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
                      ____________________________________________________________
consensus ATGGCCAGGTAGAACACCCATCTGTCCTGTAGTTGCAGGGATTATGACCATGTCAACCTC
 
. : . : . : . : . : . :
rJMSF043P07- TTTGCCGGCGAGTTCGGATGAATAA
rJMSF042P07- TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGG
rJMFF016N05- TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGA
rJMFF001J09- TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMFN036M15+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMSF043P07+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMFN033P16+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMFN046G23+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMFN032A17+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMFN032P18+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMFN013O23+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMFN009B12+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMFF051E13+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMSF042P07+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMFF016N05+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
JMFF001J09+ TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
                      ____________________________________________________________
consensus TTTGCCGGCGAGTTCGGATGAATAAGGAAGGACGAAATTGACGGTGAGCTTGGAGGGGAT
 
. : . : . : . : . : . :
rJMFF001J09- GGAGGATGGGGTGGCG
JMFN036M15+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGC
JMSF043P07+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
JMFN033P16+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
JMFN046G23+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
JMFN032A17+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
JMFN032P18+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
JMFN013O23+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
JMFN009B12+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
JMFF051E13+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
JMSF042P07+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
JMFF016N05+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
JMFF001J09+ GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
                      ____________________________________________________________
consensus GGAGGATGGGGTGGCGGGGCGAGGGGACATGTACGCCGATGGGGTCTTGGGCGGGTCAAC
 
. : . : . : . : . : . :
JMSF043P07+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
JMFN033P16+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
JMFN046G23+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
JMFN032A17+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
JMFN032P18+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
JMFN013O23+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
JMFN009B12+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
JMFF051E13+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
JMSF042P07+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
JMFF016N05+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
JMFF001J09+ GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
                      ____________________________________________________________
consensus GTTGGGGATTACTTTCTTCCAGGCCTCCAGGAAAGTAGAATCCGCGGCAGGCTCGGCGGG
 
. : . : . : . : . : . :
JMSF043P07+ CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
JMFN033P16+ CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
JMFN046G23+ CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
JMFN032A17+ CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
JMFN032P18+ CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
JMFN013O23+ CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
JMFN009B12+ CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
JMFF051E13+ CAGATCTGTGGAGAAGGGGCGACGACACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
JMSF042P07+ CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
JMFF016N05+ CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
JMFF001J09+ CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
                      ____________________________________________________________
consensus CAGATCTGTGGAGAAGGGGCGACGCCACCTCATTGTGGCGGCGCGACCTAGGAGTCTAGA
 
. : . : . : . : . : . :
JMSF043P07+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
JMFN033P16+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
JMFN046G23+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
JMFN032A17+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
JMFN032P18+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
JMFN013O23+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
JMFN009B12+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
JMFF051E13+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
JMSF042P07+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
JMFF016N05+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
JMFF001J09+ AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
                      ____________________________________________________________
consensus AGAGTGCCTGAACATGGCGGCGGAGACCGGCGGCGATGAAGGTTGCGATTTGTCGGAGCT
 
. : . : . : . : . : . :
JMSF043P07+ TTTAGAGAGAGGAAGATTGAGAGGGCGAGAGATGTTTCTATGAATCTATGCTC
JMFN033P16+ TTTAGAGTGAGGAAGATTGAGAGGGCGAGAGATG
JMFN046G23+ TTTAGAGA
JMFN032A17+ TTTAGAGAGAGGAAGATTGAGAGGGCGAGAGATGTT
JMFN032P18+ TTTAGAGAGAG
JMFN013O23+ TTTAGAGAGAGGAAGATTGAGAGGGCGAGAGATGTT
JMFN009B12+ TTTAGAGAGAGGAAGA
JMFF051E13+ TTTAGAGAGAGGAAGATTGAGAGGGCGAGAGATGTTTCTATGAATCTAT
JMSF042P07+ TTTAGAGAGAGGAAGATTGAGAGGGCGAGAGATGTTTCTATGAATCTATGCTC
JMFF016N05+ TTTAGAGAGAGGAAGATTGAGAGGGCGAGAGATGTTTCTATGAATCTATGCTC
JMFF001J09+ TTTAGAGAGAGGAAGATTGAGAGGGCGAGAGATGTTTCTATGAATCTATGCTCTTCTCTC
                      ____________________________________________________________
consensus TTTAGAGAGAGGAAGATTGAGAGGGCGAGAGATGTTTCTATGAATCTATGCTCTTCTCTC