Previous Contig 000027:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001J02Sequence563000027 (7)gb:CRO279066_16734732e-11Catharanthus roseus mRNA for hypothetical protein (ORF1), clone c12.649000027 (7)gb:CRO279066_16734736e-23Catharanthus roseus mRNA for hypothetical protein (ORF1), clone c12.
JMFF031B23Sequence558000027 (7)gb:CRO279066_16734736e-11Catharanthus roseus mRNA for hypothetical protein (ORF1), clone c12.745000027 (7)gb:CRO279066_16734736e-33Catharanthus roseus mRNA for hypothetical protein (ORF1), clone c12.
JMFN017F24Sequence508000027 (7)gb:CRO279066_16734734e-05Catharanthus roseus mRNA for hypothetical protein (ORF1), clone c12.
JMFS013F02Sequence521000027 (7)gb:CRO279066_16734731e-10Catharanthus roseus mRNA for hypothetical protein (ORF1), clone c12.
JMFS074F02Sequence627000027 (7)gb:CRO279066_16734737e-26Catharanthus roseus mRNA for hypothetical protein (ORF1), clone c12.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN017F24+ ACAAAATAAATTTTATCTATTTAACTTATCCCATTGATAATAATTAAATA
rJMFF001J02- TAAATA
rJMFF031B23- TCTATTTAACTTATCCCATTGATAATAATTAAATA
                      ____________________________________________________________
consensus ACAAAATAAATTTTATCTATTTAACTTATCCCATTGATAATAATTAAATA
 
. : . : . : . : . : . :
JMFN017F24+ TTGTATATACAAGCTTTAATCTCGATCTGATCTCTTAAATATGATGAGACCTAACAAACC
rJMFF001J02- TTGTATATACAAGCTTTAATCTCGATCTGATCTCTTAAATATGATGAGACCTAACAAACC
rJMFF031B23- TTGTATATACAAGCTTTAATCTCGATCTGATCTCTTAAATATGATGAGACCTAACAAACC
                      ____________________________________________________________
consensus TTGTATATACAAGCTTTAATCTCGATCTGATCTCTTAAATATGATGAGACCTAACAAACC
 
. : . : . : . : . : . :
JMFN017F24+ TTGTAATACTATGCTGCTAAGAAAAATACTCCGTAATAACAATAATAATTACGGTATAAG
rJMFF001J02- TTGTAATACTATGCTGCTAAGAAAAATACTCCGTAATAACAATAATAATTACGGTATAAG
rJMFF031B23- TTGTAATACTATGCTGCTAAGAAAAATACTCCGTAATAACAATAATAATTACGGTATAAG
                      ____________________________________________________________
consensus TTGTAATACTATGCTGCTAAGAAAAATACTCCGTAATAACAATAATAATTACGGTATAAG
 
. : . : . : . : . : . :
JMFN017F24+ GTTGTGCATAATACAGATCACAGTTCGAGACTAATCCAATCGAGTTTTGATCAGATCTCA
rJMFF001J02- GTTGTGCATAATACAGATCACAGTTCGAGACTAATCCAATCGAGTTTTGATCAGATCTCA
rJMFF031B23- GTTGTGCATAATACAGATCACAGTTCGAGACTAATCCAATCGAGTTTTGATCAGATCTCA
                      ____________________________________________________________
consensus GTTGTGCATAATACAGATCACAGTTCGAGACTAATCCAATCGAGTTTTGATCAGATCTCA
 
. : . : . : . : . : . :
JMFN017F24+ CCTCAACTGTTCGGAACAACTTTTCCAAGAATATTACTTAATTATTACTATATATGATTT
rJMFF001J02- CCTCAACTGTTCGGAACAACTTTTCCAAGAATATTACTTAATTATTACTATATATGATTT
rJMFF031B23- CCTCAACTGTTCGGAACAACTTTTCCAAGAATATTACTTAATTATTACTATATATGATTT
                      ____________________________________________________________
consensus CCTCAACTGTTCGGAACAACTTTTCCAAGAATATTACTTAATTATTACTATATATGATTT
 
. : . : . : . : . : . :
JMFN017F24+ AATATAAGGAAAAGCAAATTATAAGTTTTTCACAGTGTGAACTTAAACCAGGACAAGCCA
rJMFF001J02- AATATAAGGAAAAGCAAATTATAAGTTTTTCACAGTGTGAACTTAAACCAGGACAAGCCA
rJMFF031B23- AATATAAGGAAAAGCAAATTATAAGTTTTTCACAGTGTGAACTTAAACCAGGACAAGCCA
                      ____________________________________________________________
consensus AATATAAGGAAAAGCAAATTATAAGTTTTTCACAGTGTGAACTTAAACCAGGACAAGCCA
 
. : . : . : . : . : . :
JMFN017F24+ ATACTCTTAGTTGGTTTGTCAACTTCGTTTGAACAGCTGGAAGATGGAGACGACGTCGTT
rJMFF001J02- ATACTCTTAGTTGGTTTGTCAACTTCGTTTGAACAGCTGGAAGATGGAGACGACGTCGTT
rJMFF031B23- ATACTCTTAGTTGGTTTGTCAACTTCGTTTGAACAGCTGGAAGATGGAGACGACGTCGTT
                      ____________________________________________________________
consensus ATACTCTTAGTTGGTTTGTCAACTTCGTTTGAACAGCTGGAAGATGGAGACGACGTCGTT
 
. : . : . : . : . : . :
JMFN017F24+ ACGCCACCGACGGCGGCGGTTTCTGCCATTTCCGGGCAGAGGAAGAAGTTACGTGACCCC
rJMFF001J02- ACGCCACCGACGGCGGCGGTTTCTGCCATTTCCGGGCAGAGGAAGAAGTTACGTGACCCC
rJMFF031B23- ACGCCACCGACGGCGGCGGTTTCTGCCATTTCCGGGCAGAGGAAGAAGTTACGTGACCCC
                      ____________________________________________________________
consensus ACGCCACCGACGGCGGCGGTTTCTGCCATTTCCGGGCAGAGGAAGAAGTTACGTGACCCC
 
. : . : . : . : . : . :
JMFN017F24+ AACGCCGCCAGCTTTTCTGTCCTGTCCAGAC
rJMFF001J02- AACGCCGCCAGCTTTTCTGTCCTGTCCAGACTCTCTAAGCTAAACTGGGAATAATGAAGG
rJMFF031B23- AACGCCGCCAGCTTTTCTGTCCTGTCCAGACTCTCTAAGCTAAACTGGGAATAATGAAGG
JMFS074F02+ ATGAAGG
                      ____________________________________________________________
consensus AACGCCGCCAGCTTTTCTGTCCTGTCCAGACTCTCTAAGCTAAACTGGGAATAATGAAGG
 
. : . : . : . : . : . :
rJMFF001J02- CCGTAGTCGGCGGCGTTGGTGGAGGGGAGCACCGGCCGCCGTCCTTCCTTCACGTACTGG
rJMFF031B23- CCGTAGTCGGCGGCGTTGGTGGAGGGGAGCACCGGCCGCCGTCCTTCCTTCACGTACTGG
JMFS074F02+ CCGTAGTCGGCGGCGTTGGTGAAGGGGAGCACCGGCCGCCGTCCTTCCTTCACGTACTGG
                      ____________________________________________________________
consensus CCGTAGTCGGCGGCGTTGGTGGAGGGGAGCACCGGCCGCCGTCCTTCCTTCACGTACTGG
 
. : . : . : . : . : . :
rJMFF001J02- CGGAGCGCGGCGGCGATGAGGTCNTCCACCGTGGAATCCGGGCGGAATCANCACCTGCAA
rJMFF031B23- CGGAGCGCGGCGGCGATGAGGTCGTCCACCGTGGAATCC-GGCGGAATCAGCACCTGCAA
JMFS074F02+ CGGAGCGCGGCGGCGATGAGGTCGTCCACCGTGGAATCC-GGCGGAATCAGCACCTGCAA
JMFF031B23+ C-GGCGGAATCAGCACCTGCAA
JMFS013F02+ CTGCAA
JMFF001J02+ C-GGCGGAATCAGCACCTGCAA
                      ____________________________________________________________
consensus CGGAGCGCGGCGGCGATGAGGTCGTCCACCGTGGAATCC-GGCGGAATCAGCACCTGCAA
 
. : . : . : . : . : . :
rJMFF001J02- CNCGCCGGTGCTGCGCTGTATCGNCACATTCAGCAGCANCTTC
rJMFF031B23- CGCGCCGGTGCTGCGCTGTATCGTCACATTCAGCAGCAGCTTCGTTAGCTTCGGCGGGAA
JMFS074F02+ CGCGCCGGTGCTGCGCTGTATCGTCACATTCAGCAGCAGCTTCGTTAGCTTCGGCGGGAA
JMFF031B23+ CGCGCCGGTGCTGCGCTGTATCGTCACATTCAGCAGCAGCTTCGTTAGCTTCGGCGGGAA
JMFS013F02+ CGCGCCGGTGCTGCGCTGTATCGTCACATTCAGCAGCAGCTTCGTTAGCTTCGGCGGGAA
JMFF001J02+ CGCGCCGGTGCTGCGCTGTATCGTCACATTCAGCAGCAGCTTCGTTAGCTTCGGCGGGAA
                      ____________________________________________________________
consensus CGCGCCGGTGCTGCGCTGTATCGTCACATTCAGCAGCAGCTTCGTTAGCTTCGGCGGGAA
 
. : . : . : . : . : . :
rJMFF031B23- CTGCAGCGCCGCCGACGACGGCGATGTT-CCGGCGGATGAACTTCTCCGGCC
JMFS074F02+ CTGCAGCGCCGCCGACGACGGCGATGTT-CCGGCGGATGAACTTCTCCGG-CCGGCGAGT
JMFF031B23+ CTGCAGCGCCGCCGACGACGGCGATGTTCCCGGCGGATGAACTTCTCCGGCCCGGCGAGT
JMFS013F02+ CTGCAGCGCCGCCGACGACGGCGATGTT-CCGGCGGATGAACTTCTCCGG-CCGGCGAGT
JMFF001J02+ CTGCAGCGCCGCCGACGACGGCGATGTT-CCGGCGGATGAACTTCTCCGGCCCGGCGAGT
                      ____________________________________________________________
consensus CTGCAGCGCCGCCGACGACGGCGATGTT-CCGGCGGATGAACTTCTCCGGCCCGGCGAGT
 
. : . : . : . : . : . :
JMFS074F02+ AAGTCCGGCACCGTCCTCGGCCTCTGCAGCAACACCGCCGC-AGAACTCGCTCCGCTGTG
JMFF031B23+ AAGTCCGGCACCGTCCTCGGCCTCTGCAGCAACACCGCCGCAAGAACTCGCTCCGCTGTG
JMFS013F02+ AAGTCCGGCACCGTCCTCGGCCTCTGCAGCAACACCGCCGC-AGAACTCGCTCCGCTGTG
JMFF001J02+ AAGTCCGGCACCGTCCTCGGCCTCTGCAGCAACACCGCCGC-AGAACTCGCTCCGCTGTG
                      ____________________________________________________________
consensus AAGTCCGGCACCGTCCTCGGCCTCTGCAGCAACACCGCCGC-AGAACTCGCTCCGCTGTG
 
. : . : . : . : . : . :
JMFS074F02+ TCCGCTAAACGACATCGCTTTCTCTGCCAATCTCCCCTTCCTATTCTTCTCCTCCGTTCC
JMFF031B23+ TCCGCTAAACGACATCGCTTTCTCTGCCAATCTCCCCTTCCTATTCTTCTCCTCCGTTCC
JMFS013F02+ TCCGCTAAACGACATCGCTTTCTCTGCCAATCTCCCCTTCCTATTCTTCTCCTCCGTTCC
JMFF001J02+ TCCGCTAAACGACATCGCTTTCTCTGCCAATCTCCCCTTCCTATTCTTCTCCTCCGTTCC
                      ____________________________________________________________
consensus TCCGCTAAACGACATCGCTTTCTCTGCCAATCTCCCCTTCCTATTCTTCTCCTCCGTTCC
 
. : . : . : . : . : . :
JMFS074F02+ CCCTCTCCGTTGAGTCTTCGGGCTCGGCATGGGATCGAATATATATGTATCTATCTATCT
JMFF031B23+ CCCTCTCCGTTGAGTCTTCGGGCTCGGCATGGGATCGAATATATATGTATCTATCTATCT
JMFS013F02+ CCCTCTCCGTTGAGTCTTCGGGCTCGGCATGGGATCGAATATATATGTATCTATCTATCT
JMFF001J02+ CCCTCTCCGTTGAGTCTTCGGGCTCGGCATGGGATCGAATATATATGTATCTATCTATCT
                      ____________________________________________________________
consensus CCCTCTCCGTTGAGTCTTCGGGCTCGGCATGGGATCGAATATATATGTATCTATCTATCT
 
. : . : . : . : . : . :
JMFS074F02+ ATCTATATATACACACAGAGAGAGTTGTCTATAGATTGGATTTGGAAAGGTGTAGGGTTA
JMFF031B23+ ATCTATATATACACACAGAGAGAGTTGTCTATAGATTGGATTTGGAAAGGTGTAGGGTTA
JMFS013F02+ ATCTATATATACACACAGAGAGAGTTGTCTATAGATTGGATTTGGAAAGGTGTAGGGTTA
JMFF001J02+ ATCTATATATACACACAGAGAGAGTTGTCTATAGATTGGATTTGGAAAGGTGTAGGGTTA
                      ____________________________________________________________
consensus ATCTATATATACACACAGAGAGAGTTGTCTATAGATTGGATTTGGAAAGGTGTAGGGTTA
 
. : . : . : . : . : . :
JMFS074F02+ CCTGAGGCGGCGGTAACGGATGAAACGGAGGCCGGAAGCGCAGGGAGCCGGCGGCGAGCG
JMFF031B23+ CCTGAGGCGGCGGTAACGGATGAAACGGAGGCCGGAAGCGCAGGGAGCCGGCGGCGAGCG
JMFS013F02+ CCTGAGGCGGCGGTAACGGATGAAACGGAGGCCGGAAGCGCAGGGAGCCGGCGGCGAGCG
JMFF001J02+ CCTGAGGCGGCGGTAACGGATGAAACGGAGGCCGGAAGCGCAGGGAGCCGGCGGCGAGCG
                      ____________________________________________________________
consensus CCTGAGGCGGCGGTAACGGATGAAACGGAGGCCGGAAGCGCAGGGAGCCGGCGGCGAGCG
 
. : . : . : . : . : . :
JMFS074F02+ GAGGCTCTGTAGCTCCCGGCACACGGCAACGAACATAACAATAGTGGTATAAGCGTAAAT
JMFF031B23+ GAGGCTCTGTAGCTCCCGGCACACGGCAACGAACATAACAATAGTGGTATAAGCGTAAAT
JMFS013F02+ GAGGCTCTGTAGCTCCCGGCACACGGCAACGAACATAACAATAGTGGTATAAGCGTAAAT
JMFF001J02+ GAGGCTCTGTAGCTCCCGGCACACGGCAACGAACATAACAATAGTGGTATAAGCGTAAAT
                      ____________________________________________________________
consensus GAGGCTCTGTAGCTCCCGGCACACGGCAACGAACATAACAATAGTGGTATAAGCGTAAAT
 
. : . : . : . : . : . :
JMFS074F02+ AAATGTGAAACCGAGGACAAAAGG
JMFF031B23+ AAATGTGAAACCGAGGACAAAAGGCTAAAGAAGCATTAACGATTCAACGAATGAAAT
JMFS013F02+ AAATGTGAAACCGAGGACAAAAGGCTAAAGAAGCATTA
JMFF001J02+ AAATGTGAAACCGAGGACAAAAGGCTAAAGAAGCATTAACGATTCAACGAATGAAATAAC
                      ____________________________________________________________
consensus AAATGTGAAACCGAGGACAAAAGGCTAAAGAAGCATTAACGATTCAACGAATGAAATAAC