Previous Contig 000026:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001J01Sequence604000026 (2)gb:AF233284_17794341e-35Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.346000026 (2)gb:AF233284_17794341e-17Convolvulus arvensis mannose-binding lectin (cr8) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF001J01- CACC
                      ____________________________________________________________
consensus CACC
 
. : . : . : . : . : . :
JMFF001J01- AAATCAAACAAAACTTGCTCACTTTCATCTATTCCTTTTGCTTTAAAATTATCATCCAAT
                      ____________________________________________________________
consensus AAATCAAACAAAACTTGCTCACTTTCATCTATTCCTTTTGCTTTAAAATTATCATCCAAT
 
. : . : . : . : . : . :
JMFF001J01- TAAGAAACCATGGCAGTTCCTATAGATGCCGTATCTGGTCCATTGGGAAATTCCGGTGGA
                      ____________________________________________________________
consensus TAAGAAACCATGGCAGTTCCTATAGATGCCGTATCTGGTCCATTGGGAAATTCCGGTGGA
 
. : . : . : . : . : . :
JMFF001J01- GATTTTTGGAGTTTCCGACCAACTAACAAGATCAATCAAATTGTTATTCGTTCTGGTGGG
                      ____________________________________________________________
consensus GATTTTTGGAGTTTCCGACCAACTAACAAGATCAATCAAATTGTTATTCGTTCTGGTGGG
 
. : . : . : . : . : . :
JMFF001J01- TCAGGAAATAACAACCCTATTGGTATAACTTTTTCTTGCATTAACGAAGATGATTCAAAG
                      ____________________________________________________________
consensus TCAGGAAATAACAACCCTATTGGTATAACTTTTTCTTGCATTAACGAAGATGATTCAAAG
 
. : . : . : . : . : . :
JMFF001J01- GAAACGATCACAGTAGGTGGAGGTGGAACAGATACTTTAGTCACCCGTACTGACACGGTG
                      ____________________________________________________________
consensus GAAACGATCACAGTAGGTGGAGGTGGAACAGATACTTTAGTCACCCGTACTGACACGGTG
 
. : . : . : . : . : . :
rJMFF001J01+ GGATGAATNCTTGACCGAAATATGCGGAACATTTGGACCTTTC
JMFF001J01- ATTATTGATGATGACGCGGATGAATACTTGACCGAAATATGCGGAACATTTGGACCTTTC
                      ____________________________________________________________
consensus ATTATTGATGATGACGCGGATGAATACTTGACCGAAATATGCGGAACATTTGGACCTTTC
 
. : . : . : . : . : . :
rJMFF001J01+ GTAGATGATTCGTACAGTGTCTTACGATCGATAAAGTTTACAANTAATGTAAGAGAGTTC
JMFF001J01- GTAGATGATTCGTACAGTGTCTTACGATCGATAAAGTTTACAACTAATGTAAGAGAGTTC
                      ____________________________________________________________
consensus GTAGATGATTCGTACAGTGTCTTACGATCGATAAAGTTTACAACTAATGTAAGAGAGTTC
 
. : . : . : . : . : . :
rJMFF001J01+ GGACCGTACGGCCCTAATGTTGGATCGCCATTCCACTTCCAAGCTCATGATGGCAAAAAG
JMFF001J01- GGACCGTACGGCCCTAATGTTGGATCGCCATTCCACTTCCAAGCTCCTGATGGCAAAAAG
                      ____________________________________________________________
consensus GGACCGTACGGCCCTAATGTTGGATCGCCATTCCACTTCCAAGCTCCTGATGGCAAAAAG
 
. : . : . : . : . : . :
rJMFF001J01+ ATTGTNGGATTCATTGGTCGAGCTGGATTCTATGTTGATGCTATTGGTA
JMFF001J01- ATTGTTGGATTCATTGGTCGAGCTGGATTCTATGTTGATGCTATTGGTATTTACAGTGCT
                      ____________________________________________________________
consensus ATTGTTGGATTCATTGGTCGAGCTGGATTCTATGTTGATGCTATTGGTATTTACAGTGCT
 
. : . : . : . : . : . :
JMFF001J01- TAAGTGATTACATCGTCACTCTCAAGCTTAATGCTCCATTGGAACACGTCTATGTGTTGG
                      ____________________________________________________________
consensus TAAGTGATTACATCGTCACTCTCAAGCTTAATGCTCCATTGGAACACGTCTATGTGTTGG