Previous Contig 000025:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001I15Sequence567000025 (27)gb:AF492468_18049172e-37Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c397000025 (27)gb:AF492468_18049174e-20Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c
JMFF006F07Sequence409000025 (27)gb:AF492468_18049175e-19Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c
JMFF007B01Sequence195000025 (27)gb:AF492468_18049175e-09Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c
JMFF016E01Sequence616000025 (27)gb:AF492468_18049175e-47Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c743000025 (27)gb:AF492468_18049178e-52Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c
JMFF021K19Sequence412000025 (27)gb:AF492468_18049172e-24Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c457000025 (27)pir|B84682|B846824e-08probable carbonic anhydrase [imported] - Arabidopsis thaliana>gb:AC006202_153361
JMFF023A02Sequence451000025 (27)gb:AF492468_18049175e-30Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c722000025 (27)gb:AF492468_18049174e-39Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c
JMFF030N06Sequence465000025 (27)gb:AF492468_18049174e-33Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c647000025 (27)gb:AF492468_18049172e-36Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c
JMFF038D01Sequence575000025 (27)gb:AF492468_18049173e-42Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c565000025 (27)gb:AF492468_18049174e-40Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c
JMFF039I22Sequence557000025 (27)gb:AF492468_18049179e-42Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c755013278 (5)gb:AP004053_18369831e-86Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMFF047A02Sequence440000025 (27)gb:AF492468_18049173e-28Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c391000025 (27)
JMFF047M20Sequence437000025 (27)gb:AF492468_18049172e-26Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c410000025 (27)gb:AP004693_18435285e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P046
JMFF048N16Sequence438000025 (27)gb:AF492468_18049171e-27Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c365000025 (27)
JMFF050H05Sequence611000025 (27)gb:AF492468_18049177e-47Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c550000025 (27)pir|B84682|B846826e-14probable carbonic anhydrase [imported] - Arabidopsis thaliana>gb:AC006202_153361
JMFN004A08Sequence640000025 (27)gb:AF492468_18049174e-58Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c
JMFN030L04Sequence519000025 (27)gb:AF492468_18049172e-35Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c
JMFN034N15Sequence617000025 (27)pir|B84682|B846824e-13probable carbonic anhydrase [imported] - Arabidopsis thaliana>gb:AC006202_153361
JMFS085C04Sequence559000025 (27)gb:AF492468_18049172e-44Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034N15- GAACTAGTCTCAGXXXXXXXXXXXXXXXXXXCATAGAAGAAACGATATACA
                      ____________________________________________________________
consensus GAACTAGTCTCAGNNNNNNNNNNNNNNNNNNCATAGAAGAAACGATATACA
 
. : . : . : . : . : . :
rJMFF050H05- AATACATACAACACACTTAGATTATTACGTACGACACACTTAAA
rJMFF047A02- AATACATACAACACACTTAGATTATTACGTACGACACACTTAAA
rJMFF048N16- CGACACACTTAAA
JMFN034N15- TTGCACATTATGTTGAAATACATACAACACACTTAGATTATTACGTACGACACACTTAAA
                      ____________________________________________________________
consensus TTGCACATTATGTTGAAATACATACAACACACTTAGATTATTACGTACGACACACTTAAA
 
. : . : . : . : . : . :
rJMFF050H05- TTAGTTTGGATTACAAAGAAAATCCACAATCACTACTTGAAAGTATGCACGGGATGAACC
rJMFF021K19- TAGTTTGGATTACAAAGAAAATCCACAATCACTACTTGAAAGTATGCACGGGATGAACC
rJMFF047A02- TTAGTTTGGATTACAAAGAAAATCCACAATCACTACTTGAAAGTATGCACGGGATGAACC
rJMFF048N16- TTAGTTTGGATTACAAAGAAAATCCACAATCACTACTTGAAAGTATGCACGGGATGAACC
JMFN034N15- TTAGTTTGGATTACAAAGAAAATCCACAATCACTACTTGAAAGTATGCACGGGATGAACC
rJMFF023A02- ATTACAAAGAAAATCCACAATCACTACTTGAAAGTATGCACGGGATGAACC
                      ____________________________________________________________
consensus TTAGTTTGGATTACAAAGAAAATCCACAATCACTACTTGAAAGTATGCACGGGATGAACC
 
. : . : . : . : . : . :
rJMFF050H05- CCACCTTGTAACCCTAGCCTAGATTTCTCATTACTGATCGATTCAAATCAGTCATTGATG
rJMFF021K19- CCACCTTGTAACCCTAGCCTAGATTTCTCATTACTGATCGATTCAAATCAGTCATTGATG
rJMFF047A02- CCACCTTGTAACCCTAGCCTAGATTTCTCATTACTGATCGATTCAAATCAGTCATTGATG
rJMFF048N16- CCACCTTGTAACCCTAGCCTAGATTTCTCATTACTGATCGATTCAAATCAGTCATTGATG
JMFN034N15- CCACCTTGTAACCCTAGCCTAGATTTCTCATTACTGATCGATTCAAATCAGTCATTGATG
rJMFF030N06- CCCTAGCCTAGATTTCTCATTACTGATCGATTCAAATCAGTCATTGATG
rJMFF023A02- CCACCTTGTAACCCTAGCCTAGATTTCTCATTACTGATCGATTCAAATCAGTCATTGATG
                      ____________________________________________________________
consensus CCACCTTGTAACCCTAGCCTAGATTTCTCATTACTGATCGATTCAAATCAGTCATTGATG
 
. : . : . : . : . : . :
rJMFF050H05- GTCAATAGGTCACTCCCAATGAAACAGTTACATTATTTTTAACACATACAACACATCAAT
rJMFF021K19- GTCAATAGGTCACTCCCAATGAAACAGTTACATTATTTTTAACACATACAACACATCAAT
rJMFF047A02- GTCAATAGGTCACTCCCAATGAAACAGTTACATTATTTTTAACACATACAACACATCAAT
rJMFF048N16- GTCAATAGGTCACTCCCAATGAAACAGTTACATTATTTTTAACACATACCACACATCAAT
JMFN034N15- GTCAATAGGTCACTCCCAATGAAACAGTTACATTATTTTTAACACATACAACACATCAAT
rJMFF030N06- GTCAATAGGTCACTCCCAATGAAACAGTTACATTATTTTTAACACATACAACACATCAAT
rJMFF047M20- TCACTCCCAATGAAACAGTTACATTATTTTTAACACATACAACACATCAAT
rJMFF023A02- GTCAATAGGTCACTCCCAATGAAACAGTTACATTATTTTTAACACATACAACACATCAAT
rJMFF038D01- ACACATCAAT
rJMFF001I15- CAAT
rJMFF016E01- CACATCAAT
                      ____________________________________________________________
consensus GTCAATAGGTCACTCCCAATGAAACAGTTACATTATTTTTAACACATACAACACATCAAT
 
. : . : . : . : . : . :
rJMFF050H05- ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
rJMFF021K19- ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
rJMFF047A02- ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
rJMFF048N16- ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
JMFN034N15- ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
rJMFF030N06- ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
rJMFF047M20- ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
rJMFF023A02- ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
rJMFF038D01- ATTATTTATTTCNTGTACGACTCCTAAAAATTAATCGACTTTTTTANAAGTGGAATTTAT
rJMFF001I15- ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
rJMFF006F07- ATTANTCGACTTTTTTAGAAGTGGAATTTAT
rJMFF016E01- ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
                      ____________________________________________________________
consensus ATTATTTATTTCATGTACGACTCCTAAAAATTAATCGACTTTTTTAGAAGTGGAATTTAT
 
. : . : . : . : . : . :
rJMFF050H05- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
rJMFF021K19- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
rJMFF047A02- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
rJMFF048N16- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
JMFN034N15- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
rJMFF030N06- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
rJMFF047M20- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
rJMFF023A02- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
rJMFF038D01- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
rJMFF001I15- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
rJMFF006F07- TTTTAACGAGGTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
rJMFF016E01- TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
                      ____________________________________________________________
consensus TTTTAACGAGTTAACATAATTTGACATATAATAGTAGGCGGAGTATCTCTCTTCAATCTA
 
. : . : . : . : . : . :
rJMFF050H05- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCATTTATTGTCTGAAGT
rJMFF021K19- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCATTTATTGTCTGAAGT
rJMFF047A02- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCA
rJMFF048N16- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCATTTATTG
JMFN034N15- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCATTTATTGTCTGAAGT
rJMFF030N06- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCATTTATTGTCTGAAGT
rJMFF047M20- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCATTTATTGTCTGAAGT
rJMFF023A02- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCATTTATTGTCTGAAGT
rJMFF038D01- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCATTTATTGTCTGAAGT
rJMFF001I15- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCAC-AAACGATCATTTATTGTCTGAAGT
rJMFF006F07- CGTTGNGTTCTCCTGGTCTATCGATCAACTTTCNCAAAACGATCNTTTATTGTCTGAAGT
rJMFF016E01- CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCATTTATTGTCTGAAGT
                      ____________________________________________________________
consensus CGTTGTGTTCTCCTGGTCTATCGATCAACTTTCACAAAACGATCATTTATTGTCTGAAGT
 
. : . : . : . : . : . :
rJMFF050H05- GGTCTAGCATTAGTTTTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
rJMFF021K19- GGTCTAGCATTAGTTTTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
JMFN034N15- GGTCTAGCATTAGTTTTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
rJMFF030N06- GGTCTAGCATTAGTTTTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
rJMFF047M20- GGTCTAGCATTAGTTTTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
rJMFF023A02- GGTCTAGCATTAGTTTTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
rJMFF038D01- GGTCTAGCATTAGTTTTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
rJMFF001I15- GGTCTAGCATTAGTTTTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
rJMFF006F07- GGCCTAACATTANTTNTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
rJMFF016E01- GGTCTAGCATTAGTTTTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
                      ____________________________________________________________
consensus GGTCTAGCATTAGTTTTTGATTCATCATGAATGGCGTTGCGGATGAGTGCCACTTGTTGC
 
. : . : . : . : . : . :
rJMFF050H05- TTTGTAACAGATCTAATCGTTCTGATAACTGTCCAGACAACACCCTCCGTGCATGGCGGC
rJMFF021K19- TTTGTAACAGATCTAATCGTTCTGATAACTGTCCAGAC
JMFN034N15- TTTGTAACAGATCTAATCGTTCTGATAACTGTCCAGACAACACCCTCCGTGCATGGCGGC
rJMFF030N06- TTTGTAACAGATCTAATCGTTCTGATAACTGTCCAGACAACACCCTCCGTGCATGGCGGC
rJMFF047M20- TTTGTAACAGATCTAATCGTTCTGATAACTGTCCAGAACACACCCTCCGTGCATGGCGGC
rJMFF023A02- TTTGTAACAGATCTAATCGTTCTGATAACTGTCCAGACAACACCCTCCGTGCATGGCGGC
rJMFF038D01- TTTGTAACAGATCTAATCNTTCTGATAACTGTCCAGACNACACCCTCCGTGCATGGCGGC
rJMFF001I15- TTTGTAACAGATCTAATCGTTCTGATAACTGTCCAGACAACNCCCTCCGTGCATGGCGGC
rJMFF006F07- TTTGTAACANATCTAATCNTTCTGATAACTGTCCANACAACACCCTCCGTGCATGGCGGC
rJMFF016E01- TTTGTAACAGATCTAATCGTTCTGATAACTGTCCAGACAACACCCTCCGTGCATGGCGGC
JMFN004A08+ GACAACACCCTCCGTGCATGGCGGC
                      ____________________________________________________________
consensus TTTGTAACAGATCTAATCGTTCTGATAACTGTCCAGACAACACCCTCCGTGCATGGCGGC
 
. : . : . : . : . : . :
rJMFF050H05- GTTGTAAGA-AGCCCATGTACCTAT
JMFN034N15- GTTGT-AGAGAGCCCATGTACCTATAG
rJMFF030N06- GTTGTAAGAGAGCCCATGTACCTATAGTATCTTCTGCCTCTGGCTTGAAGTAAGTTTGGG
rJMFF047M20- GTTGTAAGAGAGCCCATGTACCTAT
rJMFF023A02- GTTGTAAGAGAGCCCATGTACCTATAGTATCTTCTGCCTCTGGCTTGAAGTAAGTTTGGG
rJMFF038D01- GTTGTAAGAGAGCCCATGTACCTATAGTATCTTCTGCCTCTGGCTTGAAGTAAGTTTGGG
rJMFF001I15- GTTGTAAGAGAGCCCATGTACCTATAGNATCTTCTGCCTCTGGCTTGAAGTAAGTTTGGG
rJMFF006F07- GTTGGAAGAGAGCCCATGTACCTATAGTATCTTCTGCCTCTGGCTTGAAGTAAGTTTGGG
rJMFF016E01- GTTGTAAGAGAGCCCATGTACCTATAGTATCTTCTGCCTCTGGCTTGAAGTAAGTTTGGG
JMFN004A08+ GTTGTAAGAGAGCCCATATACCTATAGTATCTTCTGCCTCTGGCTTGAAGTAAGTTTGGG
JMFF016E01+ CTCTGGCTTGAAGTAAGTTTGGG
JMFF050H05+ AAGTAAGTTTGGG
                      ____________________________________________________________
consensus GTTGTAAGAGAGCCCATGTACCTATAGTATCTTCTGCCTCTGGCTTGAAGTAAGTTTGGG
 
. : . : . : . : . : . :
rJMFF030N06- TCAAGATACCCTATACCTTTCTTTACACCCGGTGTCTCAGCAAGTTTCTTAAGATCATCC
rJMFF023A02- TCAAGATACCCTATACCTTTCTTTACACCCGGTGTCTCAGCAAGTTTCTTAAGATCATCC
rJMFF038D01- TCAAGATACCCTATACCTTTCTTTACACCCGGNGTCTCAGCNAGTTTCTTAAGATCATCC
rJMFF001I15- TCANGATACCCTATACCTTTCTTTACACCCGG
rJMFF006F07- TCAAGATACCCTATACCTTTCTTTACACCCGGTGTCTCAGCAAGTTTCTTAAGATCATCC
rJMFF016E01- TCAAGATACCCTATACCTTTCTTTACACCCGGTGTCTCAGCAAGTTTCTTAAGATCATCC
JMFN004A08+ TCAAGATACCCTATACCTTTCTTTACACCCGGTGTCTCAGCAAGTTTCTTAAGATCATCC
JMFF038D01+ TTCTTTACACCCGGTGTCTCAGCAAGTTTCTTAAGATCATCC
JMFF039I22+ TCAGCAAGTTTCTTAAGATCATCC
JMFS085C04+ ACCCTATACCTTTCTTTACACCCGGTGTCTCAGCAAGTTTCTTAAGATCATCC
JMFN030L04+ TCATCC
JMFF016E01+ TCAAGATACCCTATACCTTTCTTTACACCCGGTGTCTCAGCAAGTTTCTTAAGATCATCC
JMFF050H05+ TCAAGATACCCTATACCTTTCTTTACACCCGGTGTCTCAGCAAGTTTCTTAAGATCATCC
JMFF001I15+ TGTCTCAGCAAGTTTCTTAAGATCATCC
                      ____________________________________________________________
consensus TCAAGATACCCTATACCTTTCTTTACACCCGGTGTCTCAGCAAGTTTCTTAAGATCATCC
 
. : . : . : . : . : . :
rJMFF030N06- TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCACTGCAAGCACT
rJMFF023A02- TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCACTGCAAGCACT
rJMFF038D01- TCAATCANAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCACTGCAAGCACT
rJMFF006F07- TCNATCAGAGACAAGA
rJMFF016E01- TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCACTGCAAGCACT
JMFN004A08+ TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCACTGCAAGCACT
JMFF038D01+ TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATNTGATACATCACTGCAAGCACT
JMFF039I22+ TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCACTGCAAGCACT
JMFS085C04+ TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCAATGCAAGCACT
JMFN030L04+ TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATGTGATGCATCGCTGCAAGCACT
JMFF016E01+ TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCACTGCAAGCACT
JMFF050H05+ TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCACTGCAAGCACT
JMFF001I15+ TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCACTGCAAGCACT
                      ____________________________________________________________
consensus TCAATCAGAGACAAGATAGGATTAGGAGTTTCTCCAATCTGATACATCACTGCAAGCACT
 
. : . : . : . : . : . :
rJMFF030N06- GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCCAATCATACCTTGTTC
rJMFF023A02- GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCNAATCATACCTTGTTCC
rJMFF038D01- GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
rJMFF016E01- GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
JMFN004A08+ GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
JMFF047M20+ CCTCCAAATCATACCTTGTTCC
JMFF038D01+ GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
JMFF039I22+ GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
JMFS085C04+ GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
JMFN030L04+ GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
JMFF016E01+ GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
JMFF050H05+ GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
JMFF030N06+ CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
JMFF023A02+ ACCAGATGAGCCTCCAAATCATACCTTGTTCC
JMFF048N16+ CCAAATCATACCTTGTTCC
JMFF047A02+ CTCCAAATCATACCTGTTTCC
JMFF001I15+ GCAATCCTCCCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
                      ____________________________________________________________
consensus GCAATCCT-CCCATCATTGCTCACATGAACCAGATGAGCCTCCAAATCATACCTTGTTCC
 
. : . : . : . : . : . :
rJMFF023A02- ATTGACNACGTG
rJMFF038D01- ATTGACAACGTGTTCA
rJMFF016E01- ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFN004A08+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF047M20+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF038D01+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF039I22+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFS085C04+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFN030L04+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF016E01+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF050H05+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF030N06+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF023A02+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF048N16+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF047A02+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF021K19+ ACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
JMFF001I15+ ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
                      ____________________________________________________________
consensus ATTGACAACGTGTTCAGAGGGAAAGTGCCAGTGGACCTGTCTGAACAAATATCTGATACC
 
. : . : . : . : . : . :
rJMFF016E01- ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFN004A08+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF047M20+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF038D01+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF039I22+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFS085C04+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFN030L04+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF016E01+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF050H05+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF030N06+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF023A02+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF048N16+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF047A02+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF021K19+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
JMFF001I15+ ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
                      ____________________________________________________________
consensus ATTTATACCTAGATACCGTTGACCAAGCGGCCAACTTAACATCATGCCATAGCCATGATT
 
. : . : . : . : . : . :
rJMFF016E01- TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFN004A08+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF047M20+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF038D01+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF039I22+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFS085C04+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFN030L04+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF016E01+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF050H05+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF030N06+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF023A02+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF048N16+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF047A02+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF021K19+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
JMFF001I15+ TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
                      ____________________________________________________________
consensus TTCAAGAGTAGCAACATCTCTCATGTAGTAATTCTGAATCGGACCCAAGTTGGAATACAC
 
. : . : . : . : . : . :
rJMFF016E01- AACCGGCTTGCTCTC
JMFN004A08+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF047M20+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF038D01+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF039I22+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFS085C04+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFN030L04+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF016E01+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF050H05+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF030N06+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF023A02+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF048N16+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF047A02+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF021K19+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
JMFF007B01+ TGCACTGCCACCA
JMFF001I15+ AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
                      ____________________________________________________________
consensus AACCGGCTTGCTCTCCAGATCGATCGGAGTCTGCATCTTTCCGGCACTGCACTGCCACCA
 
. : . : . : . : . : . :
JMFN004A08+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF047M20+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF038D01+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF039I22+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFS085C04+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFN030L04+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF016E01+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF050H05+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF030N06+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF023A02+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF048N16+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF047A02+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF021K19+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
JMFF007B01+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAATTAAA
JMFF001I15+ CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
                      ____________________________________________________________
consensus CTCCGGCCGCAGCTCTCCCCAGTGAGACGGCCCTCTGTCGCTGTTTTCGTCGTAACTAAA
 
. : . : . : . : . : . :
JMFN004A08+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF047M20+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGAGT
JMFF038D01+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF039I22+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFS085C04+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFN030L04+ TCCCCACTCATCATCAAATTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF016E01+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF050H05+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF030N06+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF023A02+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF048N16+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF047A02+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF021K19+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF007B01+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
JMFF001I15+ TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
                      ____________________________________________________________
consensus TCCCCACTCATCATCAACTTCCTGAGACTTGATGACATGTGTAACTGAAAGGAGAAGA-A
 
. : . : . : . : . : . :
JMFN004A08+ AGGCAATGGAGAACAGT
JMFF047M20+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACCGTTCTGCAAT
JMFF038D01+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACCGTTCTGCAAT
JMFF039I22+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAAT
JMFS085C04+ AGGCAATGGAGAACAGTTTAAGCATGTC
JMFN030L04+ AGGCAAAGGAGAACAGTTTAAGCATGTCCATGTCT
JMFF016E01+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAAT
JMFF050H05+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAATGAATT
JMFF030N06+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAAT
JMFF023A02+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAATGAATT
JMFF048N16+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAATGAATT
JMFF047A02+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAATGAATT
JMFF021K19+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAAT
JMFF007B01+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAATAAATT
JMFF001I15+ AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAATGAATT
                      ____________________________________________________________
consensus AGGCAATGGAGAACAGTTTAAGCATGTCCATGTCTTCGATCTACAGTTTTGCAATGAATT