Previous Contig 000024:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H22Sequence534000024 (9)gb:OSJN00038_16937195e-05Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0014K14, complete seque783008183 (9)pir|B96534|B965343e-16hypothetical protein F14J22.4 [imported] - Arabidopsis thaliana>gb:AE005173_8929
JMSF008N24Sequence350000024 (9)gb:OSJN00038_16937190.014Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0014K14, complete seque730008183 (9)pir|B96534|B965347e-21hypothetical protein F14J22.4 [imported] - Arabidopsis thaliana>gb:AE005173_8929
JMSF017F04Sequence243000024 (9)709008183 (9)pir|B96534|B965342e-30hypothetical protein F14J22.4 [imported] - Arabidopsis thaliana>gb:AE005173_8929
JMSF017N19Sequence520000024 (9)gb:OSJN00038_16937192e-08Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0014K14, complete seque715008183 (9)gb:AB025624_15164602e-42Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.
JMSF036O16Sequence677000024 (9)gb:AB025624_15164602e-20Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.709008183 (9)gb:AB025624_15164602e-39Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.
JMSF037C16Sequence673000024 (9)gb:AB025624_15164602e-20Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.695008183 (9)gb:AB025624_15164605e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.
JMSF042F11Sequence780000024 (9)gb:AB025624_15164602e-24Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.753008183 (9)gb:AB025624_15164603e-45Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.
JMSF044I16Sequence746000024 (9)gb:AB073166_15231527e-22Arabidopsis thaliana DNA, chromosome 4 centromere region, BAC clone:F15N16.698008183 (9)gb:AB025624_15164605e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.
JMSF046P03Sequence720000024 (9)gb:AB025624_15164604e-27Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.681008183 (9)gb:AB025624_15164602e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042F11+ AGGTGAGGAAGAAAACCGGCGTGGATCCGAGG
                      ____________________________________________________________
consensus AGGTGAGGAAGAAAACCGGCGTGGATCCGAGG
 
. : . : . : . : . : . :
JMSF042F11+ TTGTCGGGGAGCGGGCCGGAGAAGAAATTGTTGTTGAGGAACAGAGCGTCGAGGTCTAAC
JMSF044I16+ CGGGGAGCGGGCCGGAGAAGAAATTGTTGTTGAGGAACAGAGCGTCGAGGTCTAAC
JMSF046P03+ TTGTTGAGGAACAGAGCGTCGAGGTCTAAC
                      ____________________________________________________________
consensus TTGTCGGGGAGCGGGCCGGAGAAGAAATTGTTGTTGAGGAACAGAGCGTCGAGGTCTAAC
 
. : . : . : . : . : . :
JMSF042F11+ GTGAAAACCTGCGGGTGGACCGGGCCGGTCAGCATGTTGAACCGGAGATCCAAATACGTT
JMSF044I16+ GTGAAAACCTGCGGGTGGACCGGGCCGGTCAGCATGTTGAACCGGAGATCCAAATACGTT
JMSF046P03+ GTGAAAACCTGCGGGTGGACCGGGCCGGTCAGCATGTTGAACCGGAGATCCAAATACGTT
JMSF037C16+ GACCGGGCCGGTCAGCATGTTGAACCGGAGATCCAAATACGTT
JMSF036O16+ GGTGGACCGGGCCGGTCAGCATGTTGAACCGGAGATCCAAATACGTT
                      ____________________________________________________________
consensus GTGAAAACCTGCGGGTGGACCGGGCCGGTCAGCATGTTGAACCGGAGATCCAAATACGTT
 
. : . : . : . : . : . :
JMSF042F11+ AAGTTGGTGGCTTCAAGGACGGCGGTGGGGAACGCGCCGGCGAGCTTGTTGTTGCTGAGG
JMSF044I16+ AAGTTGGTGGCTTCAAGGACGGCGGTGGGGAACGCGCCGGCGAGCTTGTTGTTGCTGAGG
JMSF046P03+ AAGTTGGTGGCTTCAAGGACGGCGGTGGGGAACGCGCCGGCGAGCTTGTTGTTGCTGAGG
JMSF037C16+ AAGTTGGTGGCTTCAAGGACGGCGGTGGGGAACGCGCCGGCGAGCTTGTTGTTGCTGAGG
JMSF036O16+ AAGTTGGTGGCTTCAAGGACGGCGGTGGGGAACGCGCCGGCGAGCTTGTTGTTGCTGAGG
                      ____________________________________________________________
consensus AAGTTGGTGGCTTCAAGGACGGCGGTGGGGAACGCGCCGGCGAGCTTGTTGTTGCTGAGG
 
. : . : . : . : . : . :
JMSF042F11+ TCAAGCTCGAAGAGCGTGGGGAATTTCTGGACGGGGATTCCCGGAGCTCCGGTGAAGTTA
JMSF044I16+ TCAAGCTCGAAGAGCGTGGGGAATTTCTGGACGGGGATTCCCGGAGCTCCGGTGAAGTTA
JMSF046P03+ TCAAGCTCGAAGAGCGTGGGGAATTTCTGGACGGGGATTCCCGGAGCTCCGGTGAAGTTA
JMSF037C16+ TCAAGCTCGAAGAGCGTGGGGAATTTCTGGACGGGGATTCCCGGAGCTCCGGTGAAGTTA
JMSF036O16+ TCAAGCTCGAAGAGCGTGGGGAATTTCTGGACGGGGATTCCCGGAGCTCCGGTGAAGTTA
JMSF017N19+ GGTGAAGTTA
                      ____________________________________________________________
consensus TCAAGCTCGAAGAGCGTGGGGAATTTCTGGACGGGGATTCCCGGAGCTCCGGTGAAGTTA
 
. : . : . : . : . : . :
JMSF042F11+ TTGGAATTCACGTGGATGACGACCAAGTCGTTGAAGGATTCCACGAAGCTGTTAAGCGAC
JMSF044I16+ TTGGAATTCACGTGGATGACGACCAAGTCGTTGAAGGATTCCACGAAGCTGTTAAGCGAC
JMSF046P03+ TTGGAATTCACGTGGATGACGACCAAGTCGTTGAAGGATTCCACGAAGCTGTTAAGCGAC
JMSF037C16+ TTGGAATTCACGTGGATGACGACCAAGTCGTTGAAGGATTCCACGAAGCTGTTAAGCGAC
JMSF036O16+ TTGGAATTCACGTGGATGACGACCAAGTCGTTGAAGGATTCCACGAAGCTGTTAAGCGAC
JMSF017N19+ TTGGAATTCACGTGGATGACGACCAAGTCGTTGAAGGATTCCACGAAGCTGTTAAGCGAC
JMFF001H22+ TTCACGTGGATGACGACCAAGTCGTTGAAGGATTCCACGAAGCTGTTAAGCGAC
                      ____________________________________________________________
consensus TTGGAATTCACGTGGATGACGACCAAGTCGTTGAAGGATTCCACGAAGCTGTTAAGCGAC
 
. : . : . : . : . : . :
JMSF042F11+ AGGCCGTTACCGTTGAAGTTGTAGCCGTTGAAGTAAATCCCACCGACCCTTTTCTTGTCG
JMSF044I16+ AGGCCGTTACCGTTGAAGTTGTAGCCGTTGAAGTAAATCCCACCGACCCTTTTCTTGTCG
JMSF046P03+ AGGCCGTTACCGTTGAAGTNGTAGCCGTTGAAGTAAATCCCACCGACCCTTTTCTTGTCG
JMSF037C16+ AGGCCGTTACCGTTGAAGTTGTAGCCGTTGAAGTAAATCCCACCGACCCTTTTCTTGTCG
JMSF036O16+ AGGCCGTTACCGTTGAAGTTGTAGCCGTTGAAGTAAATCCCACCGACCCTTTTCTTGTCG
JMSF017N19+ AGGCCGTTACCGTTGAAGTTGTAGCCGTTGAAGTAAATCCCACCGACCCTTTTCTTGTCG
JMFF001H22+ AGGCCGTTACCGTTGAAGTTGTAGCCGTTGAAGTAAATCCCACCGACCCTTTTCTTGTCG
                      ____________________________________________________________
consensus AGGCCGTTACCGTTGAAGTTGTAGCCGTTGAAGTAAATCCCACCGACCCTTTTCTTGTCG
 
. : . : . : . : . : . :
JMSF042F11+ CCGCCTCTGGGCACGTAGCAGAAGAACCCTTGGTACTTCTTCTTATTTATGCACAGCTCA
JMSF044I16+ CCGCCTCTGGGCACGTAGCAGAAGAACCCTTGGTACTTCTTCTTATTTATGCACAGCTCA
JMSF046P03+ CCGCCTCTGGGCACGTAGCAGAAGAACCCTTGGTACTTCTTCTTATTTATGCACAGCTCA
JMSF037C16+ CCGCCTCTGGGCACGTAGCAGAAGAACCCTTGGTACTTCTTCTTATTTATGCACAGCTCA
JMSF036O16+ CCGCCTCTGGGCACGTAGCAGAAGAACCCTTGGTACTTCTTCTTATTTATGCACAGCTCA
JMSF017N19+ CCGCCTCTGGGCACGTAGCAGAAGAACCCTTGGTACTTCTTCTTATTTATGCACAGCTCA
JMSF008N24+ TCTTATTTATGCACAGCTCA
JMFF001H22+ CCGCCTCTGGGCACGTAGCAGAAGAACCCTTGGTACTTCTTCTTATTTATGCACAGCTCA
                      ____________________________________________________________
consensus CCGCCTCTGGGCACGTAGCAGAAGAACCCTTGGTACTTCTTCTTATTTATGCACAGCTCA
 
. : . : . : . : . : . :
JMSF042F11+ TTGCCTTCCCAGCTTTGGGTGATGTTTTGTGGGTCATATGTTATCGATTTCTTGAAAGTC
JMSF044I16+ TTGCCTTCCCAGCTTTGGGTGACGTTTTGTGGGTCATATGTTATCGATTTCTTGAAAGTC
JMSF046P03+ TTGCCTTCCCAGCTTTGGGTGATGTTTTGTGGGTCATATGTTATCGATTTCTTGAAAGTC
JMSF037C16+ TTGCCTTCCCAGCTTTGGGTGATGTTTTGTGGGTCATATGTTATCGATTTCTTGAAAGTC
JMSF036O16+ TTGCCTTCCCAGCTTTGGGTGATGTTTTGTGGGTCATATGTTATCGATTTCTTGAAAGTC
JMSF017N19+ TTGCCTTCCCAGCTTTGGGTGATGTTTTGTGGGTCATATGTTATCGATTTCTTGAAAGTC
JMSF008N24+ TTGCCTTCCCAGCTTTGGGTGATGTTTTGTGGGTCATATGTTATCGATTTCTTGAAAGTC
JMFF001H22+ TTGCCTTCCCAGCTTTGGGTGATGTTTTGTGGGTCATATGTTATCGATTTCTTGAAAGTC
                      ____________________________________________________________
consensus TTGCCTTCCCAGCTTTGGGTGATGTTTTGTGGGTCATATGTTATCGATTTCTTGAAAGTC
 
. : . : . : . : . : . :
JMSF042F11+ CTTATGGCTTTAATCGACTTCCGTATCACCGGATCCAGCGGCGGCGGGCATGGGGGCGGC
JMSF044I16+ CTTATGGCTTTAATCGACTTCCGTATCACCGGATCCAGCGGCGGCGGGCATGGGGGCGGC
JMSF046P03+ CTTATGGCTTTAATCGACTTCCGTATCACCGGATCCAGCGGCGGCGGGCATGGGGGCGGC
JMSF037C16+ CTTATGGCTTTAATCGACTTCCGTATCACCGGATCCAGCGGCGGCGGGCATGGGGGCGGC
JMSF036O16+ CTTATGGCTTTAATCGACTTCCGTATCACCGGATCCAGCGGCGGCGGGCATGGGGGCGGC
JMSF017N19+ CTTATGGCTTTAATCGACTTCCGTATCACCGGATCCAGCGGCGGCGGGCATGGGGGCGGC
JMSF008N24+ CTTATGGCTTTAATCGACTTCCGTATCACCGGATCCAGCGGCGGCGGGCATGGGGGCGGC
JMSF017F04+ ACCGGATCCAGCGGCGGCGGGCATGGGGGCGGC
JMFF001H22+ CTTATGGCTTTAATCGACTTCCGTATCACCGGATCCAGCGGCGGCGGGCATGGGGGCGGC
                      ____________________________________________________________
consensus CTTATGGCTTTAATCGACTTCCGTATCACCGGATCCAGCGGCGGCGGGCATGGGGGCGGC
 
. : . : . : . : . : . :
JMSF042F11+ GGGGGTGGAGGTACATAACAACCACAGTCGACATTATAAACAAGGGAGACAGGAGGGGAG
JMSF044I16+ GGGGGTGGAGGTACATAACAACCACAGTCGACATTATAAACAAGGGAGGCAGGAGGGGAG
JMSF046P03+ GGGGGTGGAGGTACATAACAACCACAGTCGACATTATAAACAAGGGAGGCAGGAGGGGAG
JMSF037C16+ GGGGGTGGAGGTACATAACAACCACAGTCGACATTATAAACAAGGGAGGCAGGAGGGGAG
JMSF036O16+ GGGGGTGGAGGTACATAACAACCACAGTCGACATTATAAACAAGGGAGGCAGGAGGGGAG
JMSF017N19+ GGGGGTGGAGGTACATAACAACCACAGTCGACATTATAAACAAGGGAGGCAGGAGGGGAG
JMSF008N24+ GGGGGTGGAGGTACATAACAACCACAGTCGACATTATAAACAAGGGAGGCAGGAGGGGAG
JMSF017F04+ GGGGGTGGAGGTACATAACAACCACAGTCGACATTATAAACAAGGGAGGCAGGAGGGGAG
JMFF001H22+ GGGGGTGGAGGTACATAACAACCACAGTCGACATTATAAACAAGGGAGGCAGGAGGGGAG
                      ____________________________________________________________
consensus GGGGGTGGAGGTACATAACAACCACAGTCGACATTATAAACAAGGGAGGCAGGAGGGGAG
 
. : . : . : . : . : . :
JMSF042F11+ GTTTCTTTACTTTCTTCTTCCCCAGGCATGATTTCTGATGGAATGGCAGTGGGGAGAAGA
JMSF044I16+ GTTTCTTTACTTTCTTCTTCCCCAGGCATGATTTCTGATGGAATGGCAGTGGGGAGAAGA
JMSF046P03+ GTTTCTTTACTTTCTTCTTCCCCAGGCATGATTTCTGATGGAATGGCAGTGGGGAGAAGA
JMSF037C16+ GTTTCTTTACTTTCTTCTTCCCCAGGCATGATTTCTGATGGAATGGCAGTGGGGAGAAGA
JMSF036O16+ GTTTCTTTACTTTCTTCTTCCCCAGGCATGATTTCTGATGGAATGGCAGTGGGGAGAAGA
JMSF017N19+ GTTTCTTTACTTTCTTCTTCCCCAGGCATGATTTCTGATGGAATGGCAGTGGGGAGAAGA
JMSF008N24+ GTTTCTTTACTTTCTTCTTCCCCAGGCATGATTTCTGATGGAATGGCAGTGGGGAGAAGA
JMSF017F04+ GTTTCTTTACTTTCTTCTTCCCCAGGCATGATTTCTGATGGAATGGCAGTGGGGAGAAGA
JMFF001H22+ GTTTCTTTACTTTCTTCTTCCCCAGGCATGATTTCTGATGGAATGGCAGTGGGGAGAAGA
                      ____________________________________________________________
consensus GTTTCTTTACTTTCTTCTTCCCCAGGCATGATTTCTGATGGAATGGCAGTGGGGAGAAGA
 
. : . : . : . : . : . :
JMSF042F11+ GAGAAGAAGACAAGGAGACATTTTGCTGCTCCAAATGGGGTGAAACTGAAACTGGGTGCC
JMSF044I16+ GAGAAGAAGACAAGGAGACATTTTGCTGCTCCAAATGGGGTGAAACTGAAACTGGGTGCC
JMSF046P03+ GAGAAGAAGACAAGGAGACATTTTGCTGCTCCAAATGGGGTGAAACTGAAACTGGGTGCC
JMSF037C16+ GAGAAGAAGACAAGGAGACATTTTGCTGCTCCAAATGGGGTGAAACTGAAACTGGGTGCC
JMSF036O16+ GAGAAGAAGACAAGGAGACATTTTGCTGCTCCAAATGGGGTGAAACTGAAACTGGGTGCC
JMSF017N19+ GAGAAGAAGACAAGGAGACATTTTGCTGCTCCAAATGGGGTGAAACTGAAACTGGGTGCC
JMSF008N24+ GAGAAGAAGACAAGGAGACATTTTGCTGCTCCAAATGGGGTGAAACTGAAACTGGGTGCC
JMSF017F04+ GAGAAGAAGACAAGGAGACATTTTGCTGCTCCAAATGGGGTGAAACTGAAACTGGGTGCC
JMFF001H22+ GAGAAGAAGACAAGGAGACATTTTGCTGCTCCAAATGGGGTGAAACTGAAACTGGGTGCC
                      ____________________________________________________________
consensus GAGAAGAAGACAAGGAGACATTTTGCTGCTCCAAATGGGGTGAAACTGAAACTGGGTGCC
 
. : . : . : . : . : . :
JMSF042F11+ ATTCTCATTATGAGTGGGATTTTTTT
JMSF044I16+ ATTCTCATTATGAGTGGGATTTTTTTTG
JMSF046P03+ ATTCTCATTATGAGTGGGATTTTTTTTGCC
JMSF037C16+ ATTCTCATTATGAGTGGGATTTTTTTTGCC
JMSF036O16+ ATTCTCATTATGAGTGGGATTTTTTTTGCC
JMSF017N19+ ATTCTCATTATGAGTGGGATTTTTTTTGCC
JMSF008N24+ ATTCTCATTATGAGTGGGATTTTTTTTGCC
JMSF017F04+ ATTCTCATTATGAGTGGGATTTTTTTTG
JMFF001H22+ ATTCTCATTATGAGTGGGATTTTTTTTGCAGGAATGGAGATGGAGGTAGCCCATACATGT
                      ____________________________________________________________
consensus ATTCTCATTATGAGTGGGATTTTTTTTGCCGGAATGGAGATGGAGGTAGCCCATACATGT