Previous Contig 000023:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H20Sequence516000023 (13)gb:AB073924_15232301e-84Ipomoea nil ANS gene for anthocyanidin synthase, complete cds, strain:Beni-chido
JMFF010L09Sequence274000023 (13)gb:AB073924_15232303e-34Ipomoea nil ANS gene for anthocyanidin synthase, complete cds, strain:Beni-chido
JMFF011P24Sequence572000023 (13)gb:AB073924_15232305e-92Ipomoea nil ANS gene for anthocyanidin synthase, complete cds, strain:Beni-chido
JMFF014B17Sequence557000023 (13)gb:AB073924_15232305e-89Ipomoea nil ANS gene for anthocyanidin synthase, complete cds, strain:Beni-chido607000023 (13)gb:AB073919_15232262e-71Ipomoea nil ANS mRNA for anthocyanidin synthase, complete cds, strain:KK/ZSK-2.>
JMFF015G22Sequence564000023 (13)gb:AB073924_15232302e-96Ipomoea nil ANS gene for anthocyanidin synthase, complete cds, strain:Beni-chido726000023 (13)gb:AB073919_15232268e-92Ipomoea nil ANS mRNA for anthocyanidin synthase, complete cds, strain:KK/ZSK-2.>
JMFF016N24Sequence575000023 (13)gb:AB073924_15232301e-98Ipomoea nil ANS gene for anthocyanidin synthase, complete cds, strain:Beni-chido758000023 (13)gb:AB073919_15232262e-94Ipomoea nil ANS mRNA for anthocyanidin synthase, complete cds, strain:KK/ZSK-2.>
JMFS061C12Sequence618000023 (13)gb:AB073924_1523230e-111Ipomoea nil ANS gene for anthocyanidin synthase, complete cds, strain:Beni-chido
JMFS098A10Sequence626000023 (13)gb:AB073924_1523230e-110Ipomoea nil ANS gene for anthocyanidin synthase, complete cds, strain:Beni-chido
JMSF030E02Sequence647000023 (13)gb:AB073924_1523230e-110Ipomoea nil ANS gene for anthocyanidin synthase, complete cds, strain:Beni-chido739000023 (13)gb:AB073919_15232263e-97Ipomoea nil ANS mRNA for anthocyanidin synthase, complete cds, strain:KK/ZSK-2.>

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016N24- TCTTTTTAAGGTACAGAACTCATACGCTAAGGTACAGAATTACTA
                      ____________________________________________________________
consensus TCTTTTTAAGGTACAGAACTCATACGCTAAGGTACAGAATTACTA
 
. : . : . : . : . : . :
rJMFF014B17- TTTTTAGGTACAGAACTCATACGCTAAGGTACAAAATTGCATAACATGAGGCACAT
rJMFF016N24- ATCTTTTTAAGGTACAGAACTCATACGCTAAGGTACAAAATTGCATAACATGAGGCACAT
rJMFF015G22- AAATTGCATAACATGAGGCACAT
                      ____________________________________________________________
consensus ATCTTTTTTAGGTACAGAACTCATACGCTAAGGTACAAAATTGCATAACATGAGGCACAT
 
. : . : . : . : . : . :
rJMFF014B17- AAACACATAATACAA-GACACATACACATAC-TTTACA-GTAAAAAGAAAAAAAACCTC-
rJMFF016N24- AAACACATAATACAA-GACACATACACATAC-TTTACA-GTAAAAAGAAAAAAAACCTC-
rJMFF015G22- AAACACATAATACAA-GACACATACACATAC-TTTACA-GTAAAAAGAAAAAAAACCTC-
rJMSF030E02- ATAATACAAGGACACATACACATACTTTTACAGGTAAAAAGAAAAAAAACCTCT
                      ____________________________________________________________
consensus AAACACATAATACAA-GACACATACACATAC-TTTACA-GTAAAAAGAAAAAAAACCTC-
 
. : . : . : . : . : . :
rJMFF014B17- TAACGTAAATTAAACAAGAAACAGTGGCTGTCGTAATCAAAATTCAAAACTAAGTTGTTT
rJMFF016N24- TAACGTAAATTAAACAAGAAACAGTGGCTGTCGTAATCAAAATTCAAAACTAAGTTGTTT
rJMFF015G22- TAACGTAAATTAAACAAGAAACAGTGGCTGTCGTAATCAAAATTCAAAACTAAGTTGTTT
rJMSF030E02- TAACGTAAATTAAACAAGAAACAGTGGCTGTCGTAATCAAAATTCAAAACTAAGTTGTTT
                      ____________________________________________________________
consensus TAACGTAAATTAAACAAGAAACAGTGGCTGTCGTAATCAAAATTCAAAACTAAGTTGTTT
 
. : . : . : . : . : . :
rJMFF014B17- AGGACCTGCAATTGAATCAAGAATAAGCTAGCTAATTTGATTGATGATGATCATCATTAT
rJMFF016N24- AGGACCTGCAATTGAATCAAGAATAAGCTAGCTAATTTGATTGATGATGATCATCATTAT
rJMFF015G22- AGGACCTGCAATTGAATCAAGAATAAGCTAGCTAATTTGATTGATGATGATCATCATTAT
rJMSF030E02- AGGACCTGCAATTGAATCAAGAATAAGCTAGCTAATTTGATTGATGATGATCATCATTAT
                      ____________________________________________________________
consensus AGGACCTGCAATTGAATCAAGAATAAGCTAGCTAATTTGATTGATGATGATCATCATTAT
 
. : . : . : . : . : . :
rJMFF014B17- CAGGTTTGGGCGTGTCTGCTGCTTCCTGATCACTTTGCCTGAAGAGCTTATGCTTAATAT
rJMFF016N24- CAGGTTTGGGCGTGTCTGCTGCTTCCTGATCACTTTGCCTGAAGAGCTTATGCTTAATAT
rJMFF015G22- CAGGTTTGGGCGTGTCTGCTGCTTCCTGATCACTTTGCCTGAAGAGCTTATGCTTAATAT
rJMSF030E02- CAGGTTTGGGCGTGTCTGCTGCTTCCTGATCACTTTGCCTGAAGAGCTTATGCTTAATAT
                      ____________________________________________________________
consensus CAGGTTTGGGCGTGTCTGCTGCTTCCTGATCACTTTGCCTGAAGAGCTTATGCTTAATAT
 
. : . : . : . : . : . :
rJMFF014B17- GCTGGGCAAAAGTGCGGGGCGGGAAGCGCGGCGGCTCCGCCTCTGACACGGTCTCCGGCA
rJMFF016N24- GCTGGGCAAAAGTGCGGGGCGGGAAGCGCGGCGGCTCCGCCTCTGACACGGTCTCCGGCA
rJMFF015G22- GCTGGGCAAAAGTGCGGGGCGGGAAGCGCGGCGGCTCCGCCTCTGACACGGTCTCCGGCA
rJMSF030E02- GCTGGGCAAAAGTGCGGGGCGGGAAGCGCGGCGGCTCCGCCTCTGACACGGTCTCCGGCA
                      ____________________________________________________________
consensus GCTGGGCAAAAGTGCGGGGCGGGAAGCGCGGCGGCTCCGCCTCTGACACGGTCTCCGGCA
 
. : . : . : . : . : . :
rJMFF014B17- GGGGCTGGAGAAGGATCTTGTCCTTGGGCGGCTCACAGAAGACCGCCCAAGAAACCCTCA
rJMFF016N24- GGGGCTGGAGAAGGATCTTGTCCTTGGGCGGCTCACAGAAGACCGCCCAAGAAACCCTCA
rJMFF015G22- GGGGCTGGAGAAGGATCTTGTCCTTGGGCGGCTCACAGAAGACCGCCCAAGAAACCCTCA
rJMSF030E02- GGGGCTGGAGAAGGATCTTGTCCTTGGGCGGCTCACAGAAGACCGCCCAAGAAACCCTCA
                      ____________________________________________________________
consensus GGGGCTGGAGAAGGATCTTGTCCTTGGGCGGCTCACAGAAGACCGCCCAAGAAACCCTCA
 
. : . : . : . : . : . :
rJMFF014B17- CCTTCTCCCTGTTCACAACCCCTCTGTGGAGAATGCTCTTGTACTTGCCGTTGCTGAGAA
rJMFF016N24- CCTTCTCCCTGTTCACAACCCCTCTGTGGAGAATGCTCTTGTACTTACCGTTGCTGAGAA
rJMFF015G22- CCTTCTCCCTGTTCACAACCCCTCTGTGGAGAATGCTCTTGTACTTGCCGTTGCTGAGAA
rJMSF030E02- CCTTCTCCCTGTTCACAACCCCTCTGTGGAGAATGCTCTTGTACTTGCCGTTGCTGAGAA
                      ____________________________________________________________
consensus CCTTCTCCCTGTTCACAACCCCTCTGTGGAGAATGCTCTTGTACTTGCCGTTGCTGAGAA
 
. : . : . : . : . : . :
rJMFF014B17- TCTCGACGGTGTCACCGACGTGCATGATGATGGAGTTAGGGACGCACTTGGCGGTGACCC
rJMFF016N24- TCTCGACGGTGTCACCGACGTGCATGATGATGGAGTTAGGGACGCACTTGGCGGTGACCC
rJMFF015G22- TCTCGACGGTGTCACCGACGTGCATGATGATGGAGTTAGGGACGCACTTGGCGGTGACCC
rJMSF030E02- TCTCGACGGTGTCACCGACGTGCATGATGATGGAGTTAGGGACGCACTTGGCGGTGACCC
                      ____________________________________________________________
consensus TCTCGACGGTGTCACCGACGTGCATGATGATGGAGTTAGGGACGCACTTGGCGGTGACCC
 
. : . : . : . : . : . :
rJMFF014B17- ATTTTCCCCCGTANAAGAGCTGCANGCCGGGGACCATGTTGTGGAGGATGAAGGTGAGGG
rJMFF016N24- ATTTTCCCCCGTAGAAGAGCTGCAGGCCGGGGACCATGTTGTGGAGGATGAAGGTGAGGG
rJMFF015G22- ATTTTCCCCCGTAGAAGAGCTGCAGGCCGGGGACCATGTTGTGGAGGATGAAGGTGAGGG
rJMSF030E02- ATTTTCCCCCGTAGAAGAGCTGCAGGCCGGGGACCATGTTGTGGAGGATGAAGGTGAGGG
JMFF014B17+ GTTGTGGAGGATGAAGGTGAGGG
                      ____________________________________________________________
consensus ATTTTCCCCCGTAGAAGAGCTGCAGGCCGGGGACCATGTTGTGGAGGATGAAGGTGAGGG
 
. : . : . : . : . : . :
rJMFF014B17- CNCTGAC
rJMFF016N24- CGCTGACGTCGGTGTGAGCTTCCACGCCCAGGGCTAGCTCCGGCTGANGGCATTTTGGGT
rJMFF015G22- CGCTGACGTCGGTGTGAGCTTCCACGCCCAGGGCTAGCTCCGGCTGAGGGCATTTTGGGT
rJMSF030E02- CGCTGACGTCGGTGTGAGCTTCCACGCCCAGGGCTAGCTCCGGCTGAGGGCATTTTGGGT
JMFF014B17+ CGCTGACGTCGGTGTGAGCTTCCACGCCCAGGGCTAGCTCCGGCTGAGGGCATTTTGGGT
                      ____________________________________________________________
consensus CGCTGACGTCGGTGTGAGCTTCCACGCCCAGGGCTAGCTCCGGCTGAGGGCATTTTGGGT
 
. : . : . : . : . : . :
rJMFF016N24- AGTAGTTTATCTTCATTTGCAGAAGAAGCTCTTCCATCCCTCCCACTTCCTTCTCCA
rJMFF015G22- AGTAGTTTATCTTCATTTGCAGAAGAAGCTCTTCCATCCCTCCCACTTCCTTCTCCAGCC
rJMSF030E02- AGTAGTTTATCTTCATTTGCAGAAGAAGCTCTTCCATCCCTCCCACTTCCTTCTCCAGCC
JMFF014B17+ AGTAGTTTATCTTCATTTGCAGAAGAAGCTCTTCCATCCCTCCCACTTCCTTCTCCAGCC
                      ____________________________________________________________
consensus AGTAGTTTATCTTCATTTGCAGAAGAAGCTCTTCCATCCCTCCCACTTCCTTCTCCAGCC
 
. : . : . : . : . : . :
rJMFF015G22- TTCCTTCCTCTAACCCTAGCCCTAGTGACAGCACTGCTAAAACCTTT
rJMSF030E02- TTCCTTCCTCTAACCCTAGCCCTAGTGACAGCACTGCTAAAACCTTTGTGGCTAATGCCC
JMFF014B17+ TTCCTTCCTCTAACCCTAGCCCTAGTGACAGCACTGCTAAAACCTTTGTGGCTAATGCCC
JMFS061C12+ CCTTCCTCTAACCCTAGCCCTAGTGACAGCACTGCTAAAACCTTTGTGGCTAATGCCC
JMFS098A10+ TAACCCTAGCCCTAGTGACAGCACTGCTAAAACCTTTGTGGCTAATGCCC
JMSF030E02+ CTCTAACCCTAGCCCTAGTGACAGCACTGCTAAAACCTTTGTGGCTAATGCCC
                      ____________________________________________________________
consensus TTCCTTCCTCTAACCCTAGCCCTAGTGACAGCACTGCTAAAACCTTTGTGGCTAATGCCC
 
. : . : . : . : . : . :
rJMSF030E02- TCAGTTGCTTTGCATATTCCTTTGT
JMFF014B17+ TCAGTTGCTTTGCATATTCCTTTGTTGCATCTATGTAATCAGAAGGGGTTTTAGGCCAAA
JMFS061C12+ TCAGTTGCTTTGCATATTCCTTTGTTGCATCTATGTAATCAGAAGGGGTTTTAGGCCAAA
JMFS098A10+ TCAGTTGCTTTGCATATTCCTNTGTTGCATCTATGTAATCAGAAGGGGTTTTAGGCCAAA
JMSF030E02+ TCAGTTGCTTTGCATATTCCTTTGTTGCATCTATGTAATCAGAAGGGGTTTTAGGCCAAA
JMFF011P24+ ATCTATGTAATCAGAAGGGGTTTTAGGCCAAA
JMFF016N24+ CCTTTGTTGCATCTATGTAATCAGAAGGGGTTTTAGGCCAAA
JMFF015G22+ TCTATGTAATCAGAAGGGGTTTTAGGCCAAA
                      ____________________________________________________________
consensus TCAGTTGCTTTGCATATTCCTTTGTTGCATCTATGTAATCAGAAGGGGTTTTAGGCCAAA
 
. : . : . : . : . : . :
JMFF014B17+ TGGAGAGATCAGTCTTATCTTCGGGGAAAATGCAGTGGAAAAAGTAATCCTCCCACTCAA
JMFS061C12+ TGGAGAGATCAGTCTTATCTTCGGGGAAAATGCAGTGGAAAAAGTAATCCTCCCACTCAA
JMFS098A10+ TGGAGAGATCAGTCTTATCTTCGGGGAAAATGCAGTGGAAAAAGTAATCCTCCCACTCAA
JMSF030E02+ TGGAGAGATCAGTCTTATCTTCGGGGAAAATGCAGTGGAAAAAGTAATCCTCCCACTCAA
JMFF011P24+ TGGAGAGATCAGTCTTATCTTCGGGGAAAATGCAGTGGAAAAAGTAATCCTCCCACTCAA
JMFF016N24+ TGGAGAGATCAGTCTTATCTTCGGGGAAAATGCAGTGGAAAAAGTAATCCTCCCACTCAA
JMFF015G22+ TGGAGAGATCAGTCTTATCTTCGGGGAAAATGCAGTGGAAAAAGTAATCCTCCCACTCAA
JMFF001H20+ GGAAAATGCAGTGGAAAAAGTAATCCTCCCACTCAA
                      ____________________________________________________________
consensus TGGAGAGATCAGTCTTATCTTCGGGGAAAATGCAGTGGAAAAAGTAATCCTCCCACTCAA
 
. : . : . : . : . : . :
JMFF014B17+ GCTGCCCACTGGCATTATTTGCCAGCTTACTACCATAGCCCTGGACATTCCCCGCCGCCT
JMFS061C12+ GCTGCCTACTGGCATTATTTGCCAGCTTACTACCATAGCCCTGGACATTCCCCGCCGCCT
JMFS098A10+ GCTGCCCACTGGCATTATTTGCCAGCTTACTACCATAGCCCTGGACATTCCCCGCCGCCT
JMSF030E02+ GCTGCCCACTGGCATTATTTGCCAGCTTACTACCATAGCCCTGGACATTCCCCGCCGCCT
JMFF011P24+ GCTGCCCACTGGCATTATTTGCCAGCTTACTACCATAGCCCTGGACATTCCCCGCCGCCT
JMFF016N24+ GCTGCCCACTGGCATTATTTGCCAGCTTACTACCATAGCCCTGGACATTCCCCGCCGCCT
JMFF015G22+ GCTGCCCACTGGCATTATTTGCCAGCTTACTACCATAGCCCTGGACATTCCCCGCCGCCT
JMFF001H20+ GCTGCCCACTGGCATTATTTGCCAGCTTACTACCATAGCCCTGGACATTCCCCGCCGCCT
                      ____________________________________________________________
consensus GCTGCCCACTGGCATTATTTGCCAGCTTACTACCATAGCCCTGGACATTCCCCGCCGCCT
 
. : . : . : . : . : . :
JMFF014B17+ GGTCATTAGCGTACTTCTCTTTCTCCTCAATTGGCTGACCGAAAAACCCCTCTCCGGCAG
JMFS061C12+ GGTCATTAGCGTACTTCTCTTTCTCCTCAATTGGCTGACCGAAAAACCCCTCTCCGGCAG
JMFS098A10+ GGTCATTAGCGTACTTCTCTTTCTCCTCAATTGGCTGACCGAAAAACCCCTCTCCGGCAG
JMSF030E02+ GGTCATTAGCGTACTTCTCTTTCTCCTCAATTGGCTGACCGAAAAACCCCTCTCCGGCAG
JMFF011P24+ GGTCATTAGCGTACTTCTCTTTCTCCTCAATTGGCTGA-CGAAAAACCCCTCTCCGGCAG
JMFF016N24+ GGTCATTAGCGTACTTCTCTTTCTCCTCAATTGGCTGACCGAAAAACCCCTCTCCGGCAG
JMFF015G22+ GGTCATTAGCGTACTTCTCTTTCTCCTCAATTGGCTGACCGAAAAACCCCTCTCCGGCAG
JMFF001H20+ GGTCATTAGCGTACTTCTCTTTCTCCTCAATTGGCTGACCGAAAAACCCCTCTCCGGCAG
                      ____________________________________________________________
consensus GGTCATTAGCGTACTTCTCTTTCTCCTCAATTGGCTGACCGAAAAACCCCTCTCCGGCAG
 
. : . : . : . : . : . :
JMFF014B17+ CCTTGACGCGGTCTGTGAGCTCCTCCGATATCCCGTGGTTCACCAGGTGCATCACGCCCC
JMFS061C12+ CCTTGACGCGGCCTGTGAGCTCCTCCGATATCCCGTGGTTCACCAGGTGCATCACGCCCC
JMFS098A10+ CCTTGACGCGGCCTGTGAGCTCCTCCGATATCCCGTGGTTCACCAGGTGCATCACGCCCC
JMSF030E02+ CCTTGACGCAGCCTGTGAGCTCCTCCGATATCCCGTGGTTCACCAGGTGCATCACGCCCC
JMFF011P24+ CCTTGACGCGGCCTGTGAGCTCCTCCGATATCCCGTGGTTCACCAGGTGCATCACGCCCC
JMFF016N24+ CCTTGACGCGGCCTGTGAGCTCCTCCGATATCCCGTGGTTCACCAGGTGCATCACGCCCC
JMFF015G22+ CCTTGACGCGGCCTGTGAGCTCCTCCGATATCCCGTGGTTCACCAGGTGCATCACGCCCC
JMFF001H20+ CCTTGACGCGGCCTGTGAGCTCCTCCGATATCCCGTGGTTCACCAGGTGCATCACGCCCC
                      ____________________________________________________________
consensus CCTTGACGCGGCCTGTGAGCTCCTCCGATATCCCGTGGTTCACCAGGTGCATCACGCCCC
 
. : . : . : . : . : . :
JMFF014B17+ AGTCCACCGCCGCCTTCCGCAGCTCCTCTCGGCACTTCTCCCGCACTTCCAAGT
JMFS061C12+ AGTCCACCGCCGCCTTCCGCAGCTCCTCTCGGCACTTCTCCCGCACTTCCAAGTCCTCGG
JMFS098A10+ AGTCCACCGCCGCCTTCCGCAGCTCCTCTCGGCACTTCTCCCGCACTTCCAAGTCCTCGG
JMSF030E02+ AGTCCACCGCCGCCTTCCGCAGCTCCTCTCGGCACTTCTCCCGCACTTCCAAGTCCTCGG
JMFF011P24+ AGTCCACCGCCGCCTTCCGCAGCTCCTCTCGGCACTTCTCCCGCACTTCCAAGTCCTCGG
JMFF016N24+ AGTCCACCGCCGCCTTCCGCAGCTCCTCTCGGCACTTCTCCCGCACTTCCAAGTCCTCGG
JMFF015G22+ AGTCCACCGCCGCCTTCCGCAGCTCCTCTCGGCACTTCTCCCGCACTTCCAAGTCCTCGG
JMFF010L09+ CTCGGCACTTCTCCCGCACTTCCAAGTCCTCGG
JMFF001H20+ AGTCCACCGCCGCCTTCCGCAGCTCCTCTCGGCACTTCTCCCGCACTTCCAAGTCCTCGG
                      ____________________________________________________________
consensus AGTCCACCGCCGCCTTCCGCAGCTCCTCTCGGCACTTCTCCCGCACTTCCAAGTCCTCGG
 
. : . : . : . : . : . :
JMFS061C12+ AGTTGATCCCTTTCAAGTCCACGGTGGGGACTTGTGGCCCTCCGGCGATCTTTTCCTCCT
JMFS098A10+ AGTTGATCCCTTTCAAGTCCACGGTGGGGACTTGTGGCCCTCCGGCGATCTTTTCCTCCT
JMSF030E02+ AGTTGATCCCTTTCAAGTCCACGGTGGGGACTTGTGGCCCTCCGGCGATCTTTTCCTCCT
JMFF011P24+ AGTTGATCCCTTTCAAGTCCACGGTGGGGACTTGTGGCCCTCCGGCGATCTTTTCCTCCT
JMFF016N24+ AGTTGATCCCTTTCAAGTCCACGGTGGGGACTTGTGGCCCTCCGGCGATCTTTTCCTCCT
JMFF015G22+ AGTTGATCCCTTTCAAGTCCACGGTGGGGACTTGTGGCCCTCCGGCGATCTTTTCCTCCT
JMFF010L09+ AGTTGATCCCTTTCAAGTCCACGGTGGGGACTTGTGGCCCTCCGGCGATCTTTTCCTCCT
JMFF001H20+ AGTTGATCCCTTTCAAGTCCACGGTGGGGACTTGTGGCCCTCCGGCGATCTTTTCCTCCT
                      ____________________________________________________________
consensus AGTTGATCCCTTTCAAGTCCACGGTGGGGACTTGTGGCCCTCCGGCGATCTTTTCCTCCT
 
. : . : . : . : . : . :
JMFS061C12+ CGAAAATGTCGCCGATGCTCCTCCGCTCTTCCTCCGGCCTTATGTACTCCTTAGGGATGC
JMFS098A10+ CGAAAATGTCGCCGATGCTCCTCCGCTCTTCCTCCGGCCTTATGTACTCCTTAGGGATGC
JMSF030E02+ CGAAAATGTCGCCGATGCTCCTCCGCTCTTCCTCCGGCCTTATGTACTCCTTAGGGATGC
JMFF011P24+ CGAAAATGTCGCCGATGCTCCTCCGCTCTTCCTCCGGCCTTATGTACTCCTTAGGGATGC
JMFF016N24+ CGAAAATGTCGCCGATGCTCCTCCGCTCTTCCTCCGGCCTTATGTACTCCTTAGGGATGC
JMFF015G22+ CGAAAATGTCGCCGATGCTCCTCCGCTCTTCCTCCGGCCTTATGTACTCCTTAGGGATGC
JMFF010L09+ CGAAAATGTCGCCGATGCTCCTCCGCTCTTCCTCCGGCCTTATGTACTCCTTAGGGATGC
JMFF001H20+ CGAAAATGTCGCCGATGCTCCTCCGCTCTTCCTCCGGCCTTATGTACTCCTTAGGGATGC
                      ____________________________________________________________
consensus CGAAAATGTCGCCGATGCTCCTCCGCTCTTCCTCCGGCCTTATGTACTCCTTAGGGATGC
 
. : . : . : . : . : . :
JMFS061C12+ GTTCGATGCCGCTGCTTGCTAGCCTCTCCACCCTGCTGGGAACAGTTGCAGTAATAGTAG
JMFS098A10+ GTTCGATGCCGCTGCTTGCTAGCCTCTCCACCCTGCTGGGAACAGTTGCAGTAATAGTAG
JMSF030E02+ GTTCGATGCCGCTGCTTGCTAGCCTCTCCACCCTGCTGGGAACAGTTGCAGTAATAGTAG
JMFF011P24+ GTTCGATGCCGCTGCTTGCTAGCCTCTCCACCCTGCTGGGAACAGTTGCAGTAATAGTAG
JMFF016N24+ GTTCGATGCCGCTGCTTGCTAGCCTCTCCACCCTGCTGGGAACAGTTGCAGTAATAGTAG
JMFF015G22+ GTTCGATGCCGCTGCTTGCTAGCCTCTCCACCCTGCTGGGAACAGTTGCAGTAATAGTAG
JMFF010L09+ GTTCGATGCCGCTGCTTGCTAGCCTCTCCACCCTGCTGGGAACAGTTGCAGTAATAGTAG
JMFF001H20+ GTTCGATGCCGCTGCTTGCTAGCCTCTCCACCCTGCTGGGAACAGTTGCAGTAATAGTAG
                      ____________________________________________________________
consensus GTTCGATGCCGCTGCTTGCTAGCCTCTCCACCCTGCTGGGAACAGTTGCAGTAATAGTAG
 
. : . : . : . : . : . :
JMFS061C12+ ACACCATTATATTGTTGAAT
JMFS098A10+ ACACCATTATATTGTTGAATTATATATATATTATTT
JMSF030E02+ ACACCATTATATTGTTGAATTATATATATATTATTTCTTGTTTTTCATTCGA
JMFF011P24+ ACACCATTATATTGTTGAATTATATATATATTATTTCTTGTTTTTCATTCGA
JMFF016N24+ ACACCATTATATTGTTGAATTATATATATATTATTTCTTGTTTTTCATACGAT
JMFF015G22+ ACACCATTATATTGTTGAATTATATATATATTATTTCTTGTTTTTCATTCGAT
JMFF010L09+ ACACCATTATATTGTTGAATTATATATATATTATTTCTTGTTTTTCATTCGA
JMFF001H20+ ACACCATTATATTGTTGAATTATATATATATTATTTCTTGTTTTTCATTCGATAGATCTT
                      ____________________________________________________________
consensus ACACCATTATATTGTTGAATTATATATATATTATTTCTTGTTTTTCATTCGATAGATCTT