Previous Contig 000022:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001C23Sequence336000022 (159)gb:AY373974_16034595e-48Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.775000022 (159)gb:AY373974_1603459e-128Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF001H18Sequence521000022 (159)gb:AY373974_16034592e-70Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.798000022 (159)gb:AY373974_1603459e-103Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF003E22Sequence608000022 (159)gb:AY373974_16034599e-89Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF003O21Sequence388000022 (159)gb:AY373974_16034595e-47Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.437000022 (159)gb:AY373974_16034593e-28Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF003P11Sequence310000022 (159)gb:AY373974_16034593e-42Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF004M23Sequence510000022 (159)gb:AY373974_16034593e-70Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.758000022 (159)gb:AY373974_1603459e-104Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF005G14Sequence471000022 (159)gb:AY373974_16034591e-70Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.691000022 (159)gb:AY373974_16034592e-89Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF005I18Sequence468000022 (159)gb:AY373974_16034592e-62Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.740000022 (159)gb:AY373974_1603459e-104Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF005O06Sequence467000022 (159)gb:AY373974_16034595e-62Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.750000022 (159)gb:AY373974_1603459e-122Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF005P12Sequence471000022 (159)gb:AY373974_16034598e-71Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.724000022 (159)gb:AY373974_16034596e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF006A18Sequence525000022 (159)gb:AY373974_16034592e-71Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.764000022 (159)gb:AY373974_16034596e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF006C11Sequence572000022 (159)gb:AY373974_16034594e-79Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.768000022 (159)gb:AY373974_1603459e-103Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF006F19Sequence506000022 (159)gb:AY373974_16034592e-70Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.736000022 (159)gb:AY373974_16034593e-85Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF007F19Sequence471000022 (159)gb:AY373974_16034595e-63Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.721000022 (159)gb:AY373974_16034596e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF008A22Sequence626000022 (159)gb:AY373974_16034591e-90Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.750000022 (159)gb:AY373974_16034598e-87Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF008C07Sequence471000022 (159)gb:AY373974_16034595e-63Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.717000022 (159)gb:AY373974_16034597e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF008H05Sequence506000022 (159)gb:AY373974_16034592e-70Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.765000022 (159)gb:AY373974_1603459e-103Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF009E02Sequence548000022 (159)gb:AY373974_16034593e-77Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.650000022 (159)gb:AY373974_16034598e-73Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF010A07Sequence521000022 (159)gb:AY373974_16034593e-69Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.722000022 (159)gb:AY373974_16034596e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF010M21Sequence626000022 (159)gb:AY373974_16034592e-91Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.766000022 (159)gb:AY373974_16034591e-97Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF010N08Sequence555000022 (159)gb:AY373974_16034594e-78Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.719000022 (159)gb:AY373974_16034592e-94Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF011D01Sequence512000022 (159)gb:AY373974_16034592e-71Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.681000022 (159)gb:AY373974_16034598e-74Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF011H05Sequence581000022 (159)gb:AY373974_16034596e-82Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.761000022 (159)gb:AY373974_16034598e-92Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF011J09Sequence558000022 (159)gb:AY373974_16034598e-76Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.736000022 (159)gb:AY373974_16034593e-98Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF011N06Sequence629000022 (159)gb:AY373974_16034594e-92Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.723000022 (159)gb:AY373974_16034596e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF012G12Sequence560000022 (159)gb:AY373974_16034594e-79Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.474000022 (159)gb:AY373974_16034595e-33Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF014B12Sequence471000022 (159)gb:AY373974_16034595e-63Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.778000022 (159)gb:AY373974_1603459e-105Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF014C06Sequence541000022 (159)gb:AY373974_16034593e-76Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.758000022 (159)gb:AY373974_16034596e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF014E12Sequence785000022 (159)gb:AY373974_1603459e-107Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF014E14Sequence464000022 (159)gb:AY373974_16034594e-38Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF014E17Sequence506000022 (159)gb:AY373974_16034592e-70Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.780000022 (159)gb:AY373974_1603459e-103Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF014J09Sequence555000022 (159)gb:AY373974_16034593e-76Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.724000022 (159)gb:AY373974_16034599e-96Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF015A08Sequence582000022 (159)gb:AY373974_16034595e-81Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.619000022 (159)gb:AY373974_16034597e-73Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF015A19Sequence532000022 (159)gb:AY373974_16034591e-62Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF016B20Sequence555000022 (159)gb:AY373974_16034592e-78Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.764000022 (159)gb:AY373974_16034593e-98Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF016N23Sequence581000022 (159)gb:AY373974_16034596e-82Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.735000022 (159)gb:AY373974_16034591e-89Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF018L14Sequence456000022 (159)gb:AY373974_16034592e-69Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF019A11Sequence606000022 (159)gb:AY373974_16034599e-89Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.717000022 (159)gb:AY373974_16034597e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF020H05Sequence563000022 (159)gb:AY373974_16034592e-79Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.725000022 (159)gb:AY373974_16034592e-90Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF021L09Sequence518000022 (159)gb:AY373974_16034592e-70Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.761000022 (159)gb:AY373974_1603459e-102Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF024L04Sequence462000022 (159)gb:AY373974_16034592e-61Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.801000022 (159)gb:AY373974_1603459e-103Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF024P12Sequence471000022 (159)gb:AY373974_16034595e-63Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.786000022 (159)gb:AY373974_1603459e-107Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF028C20Sequence524000022 (159)gb:AY373974_16034594e-73Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.586000022 (159)gb:AY373974_16034596e-61Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF029O09Sequence347000022 (159)gb:AY373974_16034593e-40Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.704000022 (159)gb:AY373974_16034595e-84Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF032O09Sequence628000022 (159)gb:AY373974_16034593e-92Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.716000022 (159)gb:AY373974_16034595e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF033E19Sequence627000022 (159)gb:AY373974_16034592e-90Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.757000022 (159)gb:AY373974_16034596e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF033F05Sequence524000022 (159)gb:AY373974_16034594e-73Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.752000022 (159)gb:AY373974_1603459e-104Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF034C21Sequence645000022 (159)gb:AY373974_16034591e-81Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF034I16Sequence580000022 (159)gb:AY373974_16034596e-82Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.769000022 (159)gb:AY373974_16034593e-97Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF034M24Sequence565000022 (159)gb:AY373974_16034595e-80Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.604000022 (159)gb:AY373974_16034596e-68Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF035P14Sequence522000022 (159)gb:AY373974_16034594e-73Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.694000022 (159)gb:AY373974_16034592e-87Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF036B17Sequence545000022 (159)gb:AY373974_16034591e-76Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.732000022 (159)gb:AY373974_1603459e-104Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF037D10Sequence478000022 (159)gb:AY373974_16034595e-63Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.778000022 (159)gb:AY373974_1603459e-109Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF037P22Sequence585000022 (159)gb:AY373974_16034594e-77Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.758000022 (159)gb:AY373974_1603459e-104Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF038M17Sequence606000022 (159)gb:AY373974_16034599e-89Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.725000022 (159)gb:AY373974_16034599e-96Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF038O13Sequence719000022 (159)gb:AY373974_16034596e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF039A12Sequence753000022 (159)gb:AY373974_16034597e-99Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF039A19Sequence556000022 (159)gb:AY373974_16034595e-78Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.686000022 (159)gb:AY373974_16034593e-85Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF039H13Sequence469000022 (159)gb:AY373974_16034592e-62Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.695000022 (159)gb:AY373974_16034597e-95Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF039N17Sequence525000022 (159)gb:AY373974_16034591e-73Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.763000022 (159)gb:AY373974_1603459e-103Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF040J14Sequence746000022 (159)gb:AY373974_1603459e-103Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF040P23Sequence607000022 (159)gb:AY373974_16034599e-89Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.788000022 (159)gb:AY373974_1603459e-122Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF041B08Sequence656000022 (159)gb:AY373974_16034597e-99Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.594000022 (159)gb:AY373974_16034592e-61Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF041N07Sequence655000022 (159)gb:AY373974_16034592e-96Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.588000022 (159)gb:AY373974_16034595e-63Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF044C01Sequence612000022 (159)gb:AY373974_16034592e-89Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.617000022 (159)gb:AY373974_16034597e-65Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF044C12Sequence633000022 (159)gb:AY373974_16034592e-89Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.613000022 (159)gb:AY373974_16034597e-73Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF044N10Sequence607000022 (159)gb:AY373974_16034599e-89Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.620000022 (159)gb:AY373974_16034593e-65Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF045C19Sequence601000022 (159)gb:AY373974_16034596e-88Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF045M05Sequence603000022 (159)gb:AY373974_16034599e-89Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.604000022 (159)gb:AY373974_16034593e-67Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF046P19Sequence560000022 (159)gb:AY373974_16034592e-78Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.515000022 (159)gb:AY373974_16034595e-46Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF047A16Sequence423000022 (159)gb:AY373974_16034591e-61Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.375000022 (159)gb:AY373974_16034592e-15Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF047G19Sequence530000022 (159)gb:AY373974_16034592e-67Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF047L07Sequence613000022 (159)gb:AY373974_16034594e-84Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.257021793
JMFF047M04Sequence463000022 (159)gb:AY373974_16034595e-62Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.437000022 (159)gb:AY373974_16034599e-31Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF048J19Sequence226000022 (159)gb:AY373974_16034594e-23Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.245000022 (159)
JMFF048K02Sequence441000022 (159)gb:AY373974_16034591e-52Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF049A01Sequence472000022 (159)gb:AY373974_16034599e-64Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.411000022 (159)gb:AY373974_16034599e-31Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF049A12Sequence385000022 (159)gb:AY373974_16034591e-47Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF049G08Sequence576000022 (159)gb:AY373974_16034596e-82Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.612000022 (159)gb:AY373974_16034596e-69Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF050G16Sequence593000022 (159)gb:AY373974_16034592e-86Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.590000022 (159)gb:AY373974_16034592e-51Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFF051G22Sequence593000022 (159)gb:AY373974_16034593e-86Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.540000022 (159)gb:AY373974_16034595e-49Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFN005J23Sequence517000022 (159)gb:AY373974_16034597e-53Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFN006P04Sequence626000022 (159)gb:AY373974_1603459e-115Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFN019P20Sequence610000022 (159)gb:AY373974_16034591e-90Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFN030N01Sequence607000022 (159)gb:AY373974_16034599e-82Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFN036C04Sequence581000022 (159)gb:AY373974_16034594e-87Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFS037D03Sequence595000022 (159)gb:AY373974_16034593e-87Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFS062D04Sequence609000022 (159)gb:AY373974_16034598e-91Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFS144B05Sequence626000022 (159)gb:AY373974_1603459e-102Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFS163G08Sequence553000022 (159)gb:AY373974_16034591e-79Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMFS163H05Sequence587000022 (159)gb:AY373974_16034594e-87Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.
JMSF002M12Sequence310000022 (159)gb:AY373974_16034592e-09Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.311000022 (159)gb:AY373974_16034592e-09Ipomoea batatas cysteine proteinase precursor, mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047A16- CCTTATGGCGGATCACCCTGGAGAGTTTTTT
rJMFF044N10- TTAATAATAGATATAA
rJMFF029O09- TTAATAATAGATATAA
rJMFF006F19- TTAATAATAGATATAA
rJMFF011H05- TAATAATAGATATAA
rJMFF008A22- TAATAGATATAA
rJMFF009E02- ATAATAGATATAA
rJMFF041N07- AA
rJMFF048J19- TAA
rJMFF006A18- TAATAATAGATATAA
rJMFF033E19- TAGATATAA
rJMFF014C06- ATAGATATAA
rJMFF024L04- ATAGATATAA
                      ____________________________________________________________
consensus CCTTATGGCGGATCATTAATAATAGATATAA
 
. : . : . : . : . : . :
rJMFF047A16- TTTTTTTTTTCTTTTTTTTTTTTAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF044N10- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF029O09- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF006F19- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF011H05- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF008A22- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF009E02- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF049G08- ACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF045M05- ACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF044C01- TACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF041N07- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF051G22- GACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF014E14- ACC
rJMSF002M12- AGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
JMFN005J23+ CAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF046P19- TACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF049A01- ACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF047M04- TAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
JMSF002M12+ GACTAGAGATAATATTAACTTATGAGGATTACATTCCAANGAAAACC
rJMFF048J19- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF006A18- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF033E19- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF014C06- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF011N06- TATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF032O09- TTATGAGGATTACATTCCAAAGAAAACC
rJMFF020H05- ATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF024L04- CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF014E17- AGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF039N17- ATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF004M23- TTATGAGGATTACATTCCAAAGAAAACC
rJMFF034I16- ATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF034M24- TTATGAGGATTACATTCCAAAGAAAACC
rJMFF010M21- TATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF011J09- AAGAAAACC
rJMFF016B20- ATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF039A12- AGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF040J14- TTACATTCCAAAGAAAACC
rJMFF036B17- AACC
rJMFF038M17- ATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF014J09- TATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF010A07- TATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF005P12- TATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF007F19- ATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF038O13- TAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF019A11- TAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF008C07- TAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF010N08- TTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF016N23- AGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF039H13- AAAGAAAACC
rJMFF035P14- ACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF039A19- AGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF005G14- ACC
rJMFF011D01- TAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF034C21- TTACATTCCAAAGAAAACC
rJMFF015A08- AGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF044C12- AATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF015A19- AGAAAACC
rJMFF050G16- TAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF041B08- GACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF012G12- CC
rJMFF001H18- AGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF021L09- AACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF008H05- ATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF037P22- TATGAGGATTACATTCC-AAGAAAACC
rJMFF033F05- ATTACATTCCAAAGAAAACC
rJMFF005I18- AAGAAAACC
rJMFF006C11- ATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF014B12- ATATTAACTTATGAGGATTACATTCCAAAGAAAACC
rJMFF037D10- AAGAAAACC
rJMFF014E12- AAGAAAACC
rJMFF024P12- AAGAAAACC
                      ____________________________________________________________
consensus CACAACTACACAAGACTAGAGATAATATTAACTTATGAGGATTACATTCCAAAGAAAACC
 
. : . : . : . : . : . :
rJMFF047A16- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF044N10- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF029O09- TACTACGTGGCAGACAGCG--TAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF006F19- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF011H05- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF008A22- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF009E02- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF049G08- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF045M05- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF044C01- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF041N07- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF051G22- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF014E14- TACTACGTGGCNGACAGCGCTTAGGCACTGTTNTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF003O21- CAGCGCTTANGCNCGGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMSF002M12- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
JMFN005J23+ TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF046P19- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF049A01- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF047M04- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
JMSF002M12+ TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF048J19- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF006A18- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF033E19- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF014C06- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF011N06- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF032O09- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF020H05- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF024L04- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF014E17- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF039N17- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF004M23- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF034I16- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF034M24- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF010M21- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF011J09- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF016B20- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF039A12- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF040J14- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF036B17- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF038M17- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF014J09- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF010A07- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF005P12- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF007F19- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF038O13- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF019A11- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF008C07- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF010N08- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF016N23- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF039H13- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF035P14- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF039A19- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF005G14- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF011D01- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF034C21- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF015A08- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF044C12- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF028C20- AGCGCTTAGGCACAGNTCTGTGGCGTCTANAGAGCCAAGAAACNN
JMFN030N01+ GACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF015A19- TACTACGTGGCAGACNGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF050G16- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF041B08- TACTACGGGGCAAACAGCGCTTAGGCACAGTTTTGGGGCGTTTAAAGAGCCAAGAAACAG
rJMFF012G12- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTANAGAGNCAAGAAACAG
rJMFF001H18- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF021L09- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF008H05- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF037P22- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF033F05- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF005I18- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF006C11- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF014B12- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF037D10- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF014E12- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF024P12- TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
rJMFF040P23- GAGAGCCAAGAAACAG
                      ____________________________________________________________
consensus TACTACGTGGCAGACAGCGCTTAGGCACAGTTCTGTGGCGTCTAGAGAGCCAAGAAACAG
 
. : . : . : . : . : . :
rJMFF047A16- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF044N10- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF029O09- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF006F19- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF011H05- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF008A22- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF009E02- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF049G08- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF045M05- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF044C01- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF041N07- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF051G22- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF014E14- ATATTCAATCATACACA-GTACATGCAGATTTTTTGNCTTTGAATATTTACAAAAACTGA
rJMFF003O21- ATATTCAATCATACNNA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMSF002M12- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
JMFN005J23+ ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF046P19- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF049A01- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF047M04- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
JMSF002M12+ ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF048J19- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF006A18- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF033E19- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF014C06- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF011N06- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF032O09- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF020H05- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF024L04- ATATTCAATCATACACA-GTACATGCAGATTTTTTGCCTTTGAATATTTACAAAAATTGA
rJMFF014E17- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF039N17- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF004M23- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF034I16- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF034M24- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF010M21- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF011J09- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF016B20- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF039A12- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF040J14- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF036B17- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF038M17- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF014J09- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF010A07- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF005P12- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF007F19- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF038O13- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF019A11- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF008C07- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF010N08- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF016N23- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF039H13- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF035P14- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF039A19- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF005G14- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF011D01- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF034C21- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF015A08- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF044C12- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF028C20- ATATTCAATCATACNCN-GTACATGCAGATTTTTTGTCTTTGAATATTTACNNAAACTGA
JMFN030N01+ ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF015A19- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF050G16- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF041B08- ATTTTCAATCTTCCACA-GTCCATGCAGATTTTTGGTCTTTGAATATTTACAAAAACTGA
rJMFF012G12- ATATTCAATCATACACATGTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF001H18- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF021L09- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF008H05- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF037P22- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF033F05- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF005I18- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF006C11- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF014B12- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF037D10- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF014E12- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF024P12- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF040P23- ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF005O06- TGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
rJMFF001C23- CAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
                      ____________________________________________________________
consensus ATATTCAATCATACACA-GTACATGCAGATTTTTTGTCTTTGAATATTTACAAAAACTGA
 
. : . : . : . : . : . :
rJMFF047A16- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF044N10- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF029O09- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF006F19- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF011H05- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTANAGATTTACTGCTT
rJMFF008A22- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF009E02- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF049G08- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF045M05- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF044C01- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF041N07- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF051G22- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF014E14- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTANAGATTTACTGCTT
rJMFF003O21- GTAAAGNATCTAANATGCANCCNTAACTTATTACNCNATACACCTANAGATTTACTGCTT
rJMSF002M12- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
JMFN005J23+ GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF046P19- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF049A01- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF047M04- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
JMSF002M12+ GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF048J19- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF006A18- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF033E19- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF014C06- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF011N06- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF032O09- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF020H05- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF024L04- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF014E17- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF039N17- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF004M23- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF034I16- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF034M24- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF010M21- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF011J09- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF016B20- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF039A12- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF040J14- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF036B17- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF038M17- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF014J09- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF010A07- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF005P12- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF007F19- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF038O13- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF019A11- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF008C07- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF010N08- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF016N23- GTAAAGCATCTAANATGCAACCATAACTTATTACACGATACACCTANAGATTTACTGCTT
rJMFF039H13- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF035P14- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF039A19- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF005G14- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF011D01- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF034C21- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF015A08- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF044C12- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF028C20- GTANAGCATCTAAGATGCAACCATAACTTATTACNCGATACACCTANAGANTTACTGCTC
JMFN030N01+ GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF015A19- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF050G16- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF041B08- GTAAAGCATTTAAAATGCACCCATAACTTATTACACGATCCACCTAGAGATTTACTGTTT
rJMFF012G12- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTANAGATTTACTGCTT
rJMFF001H18- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF021L09- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF008H05- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF037P22- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF033F05- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF005I18- GTAAAGCATCTAAGATGCAACCATAACTTATTACACCATACACCTAGAGATTTACTGCTT
rJMFF006C11- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF014B12- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF037D10- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF014E12- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGAT--ACCTAGAGATTTACTGCTT
rJMFF024P12- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGAT--ACCTAGAGATTTACTGCTT
rJMFF040P23- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF005O06- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
rJMFF001C23- GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
                      ____________________________________________________________
consensus GTAAAGCATCTAAGATGCAACCATAACTTATTACACGATACACCTAGAGATTTACTGCTT
 
. : . : . : . : . : . :
rJMFF047A16- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF044N10- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF029O09- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF006F19- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF011H05- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF008A22- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF009E02- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF049G08- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF045M05- AATAGTGCTAGCAACAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF044C01- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF041N07- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF051G22- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF014E14- AATAGTGCTANCAGNANNCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF003O21- AATANTGCTANCAGCAGNCACGGNTGAAACCATGGAATCTATCCCACNNATATTATTGCC
rJMSF002M12- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
JMFN005J23+ AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF046P19- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF049A01- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF047M04- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
JMSF002M12+ AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF048J19- A
rJMFF006A18- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF033E19- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF014C06- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF011N06- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF032O09- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF020H05- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF024L04- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF014E17- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF039N17- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF004M23- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF034I16- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF034M24- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF010M21- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF011J09- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF016B20- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF039A12- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF040J14- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF036B17- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF038M17- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF014J09- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF010A07- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF005P12- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF007F19- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF038O13- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF019A11- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF008C07- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF010N08- AATAGTGCTAGCAACAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF016N23- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF039H13- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF035P14- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF039A19- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF005G14- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF011D01- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF034C21- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF015A08- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF044C12- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF028C20- NATAGTGCTAGCAGCAGTCACGGTTGANACCATGGAATCTATCCCACAGATATTATTGCC
JMFN030N01+ AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF015A19- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF050G16- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGAC
rJMFF041B08- AATAGGGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF012G12- AATANTGCTNGCANCAGTCNCGGTTGAAACCATGGAATCTATCCCANAGATATTATTGCC
rJMFF001H18- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF021L09- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF008H05- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF037P22- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF033F05- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF005I18- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF006C11- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF014B12- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF037D10- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF014E12- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF024P12- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF040P23- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF005O06- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
rJMFF001C23- AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
                      ____________________________________________________________
consensus AATAGTGCTAGCAGCAGTCACGGTTGAAACCATGGAATCTATCCCACAGATATTATTGCC
 
. : . : . : . : . : . :
rJMFF047A16- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCA
rJMFF044N10- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF029O09- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF006F19- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF011H05- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF008A22- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF009E02- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF049G08- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF045M05- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF044C01- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF041N07- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF051G22- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF014E14- CCTGCNGATCTTGTAATATCCTTCCTCTCCCCAGNTTTCTCCCCAAGAATTCTTGACGAT
rJMFF003O21- CCTGNANATCTTGTAATATCCTTCCTCTCCCCAGNTTTCTCCCCANGAATTCTTGACNAT
rJMSF002M12- CCTGCAGATCTTGTAATATCCTTC
JMFN005J23+ CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF046P19- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF049A01- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF047M04- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
JMSF002M12+ CCTGCAGATCTTGTAATATCCTTC
rJMFF006A18- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF033E19- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF014C06- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF011N06- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF032O09- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF020H05- CCTGCAGATCTTGTANTATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF024L04- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF014E17- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF039N17- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF004M23- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF034I16- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF034M24- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF010M21- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF011J09- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF016B20- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF039A12- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF040J14- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF036B17- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF038M17- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF014J09- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF010A07- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF005P12- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF007F19- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF038O13- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF019A11- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF008C07- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF010N08- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF016N23- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF039H13- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF035P14- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF039A19- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF005G14- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF011D01- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF034C21- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF015A08- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF044C12- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF028C20- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCNCCAAGAATTCTTGACGAT
JMFN030N01+ CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF015A19- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF050G16- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF041B08- CCTGCAAATCTTGTAATATCCTTCCTTTCCCCAGTTTTTTCCCCAAGAATTCTTGACGAT
rJMFF012G12- CCTGCAGATCTTGNAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF001H18- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF021L09- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF008H05- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF037P22- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF033F05- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF005I18- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF006C11- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF014B12- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF037D10- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF014E12- CCTGCAGATCTTGTA--ATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF024P12- CCTGCAGATCTTGTA--ATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF040P23- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF005O06- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
rJMFF001C23- CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
JMFN006P04+ GAT
                      ____________________________________________________________
consensus CCTGCAGATCTTGTAATATCCTTCCTCTCCCCAGTTTTCTCCCCAAGAATTCTTGACGAT
 
. : . : . : . : . : . :
rJMFF044N10- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF029O09- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF006F19- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF011H05- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF008A22- CCAGTATGGCTCGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF009E02- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF049G08- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF045M05- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF044C01- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF041N07- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF051G22- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF014E14- CCANNATGGCTTGTCCTTGANCCTAATAGGGGCGTAGNCTGCGGCACCNTACCCCACTAA
rJMFF003O21- CCAGNATGGCTTGTCCTTGAANCTAATAGGGGCGTAGCCTGCGGCACCATACCNCACTAA
JMFN005J23+ CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF046P19- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF049A01- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTA
rJMFF047M04- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTA
rJMFF006A18- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF033E19- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF014C06- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF011N06- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF032O09- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF020H05- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF024L04- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF014E17- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF039N17- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF004M23- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF034I16- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF034M24- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF010M21- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF011J09- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF016B20- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF039A12- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF040J14- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF036B17- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF038M17- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF014J09- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF010A07- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF005P12- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF007F19- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF038O13- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF019A11- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF008C07- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF010N08- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF016N23- CCAGTATGGCTTGTCCTTGANCCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF039H13- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF035P14- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF039A19- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF005G14- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF011D01- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF034C21- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF015A08- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF044C12- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF028C20- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGNAGCCTGCGGCACCATACCCCACTAA
JMFN030N01+ CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF015A19- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF050G16- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF041B08- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF012G12- NCNNTATGGCTTGTCCTTGANCCTANTANGGGCGTANCCTGCGGCACCATACCCCACTAN
rJMFF001H18- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF021L09- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF008H05- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF037P22- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF033F05- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF005I18- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF006C11- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF014B12- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF037D10- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF014E12- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF024P12- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF040P23- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF005O06- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
rJMFF001C23- CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
JMFN006P04+ CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
                      ____________________________________________________________
consensus CCAGTATGGCTTGTCCTTGAACCTAATAGGGGCGTAGCCTGCGGCACCATACCCCACTAA
 
. : . : . : . : . : . :
rJMFF044N10- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF029O09- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF006F19- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF011H05- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-NAATGTATGGGCAGGAAACTCCTCCGA
rJMFF008A22- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGAAGGAAACTCCTCCGA
rJMFF009E02- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF049G08- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF045M05- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF044C01- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF041N07- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF051G22- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF014E14- NAGCACCCCNTGGTCCNAATTTCTCTTTGAAC-NAATGTATGGGCNGGANAATCCTCCGA
rJMFF003O21- NAGNACCCCGNGGTCCNAATTTCTCTTTGAAC-NNATGTATGGGCANGAAAATCCTCCGA
JMFN005J23+ GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF046P19- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF006A18- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF033E19- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF014C06- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF011N06- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF032O09- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF020H05- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF024L04- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF014E17- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF039N17- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF004M23- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF034I16- GAGCACCCCGTGGTCCAAATTTCTCTTTGAACAAAATGTATGGGCAGGAAACTCCTCCGA
rJMFF034M24- GAGCACCCCGTGGTCCAAATTTCTCTTTGAACAAAATGTATGGGCAGGAAACTCCTCCGA
rJMFF010M21- GAGCACCCCGTGGTCCAAATTTCTCTTTGAACAAAATGTATGGGCAGGAAACTCCTCCGA
rJMFF011J09- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF016B20- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF039A12- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF040J14- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF036B17- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF038M17- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF014J09- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF010A07- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF005P12- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF007F19- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF038O13- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF019A11- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF008C07- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF010N08- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF016N23- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-NAATGTATGGGCAGGAAACTCCTCCGA
rJMFF039H13- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF035P14- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF039A19- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF005G14- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF011D01- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF034C21- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF015A08- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF044C12- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF028C20- GAGCACCCCGTGGTCCNAATTTCTCTTTGANC-AANTGTATGGGCAGGAAACTCCTCCGA
JMFN030N01+ GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF015A19- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF050G16- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF041B08- AAGCACCCCGGGGTCCAAATTTCTTTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF012G12- NAGCACCCCGTGGTNCAAATTTCTCTTTGAAC-NNATGTATGGGCANGAAACTCCTCCGA
rJMFF001H18- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF021L09- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF008H05- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF037P22- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF033F05- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF005I18- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF006C11- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF014B12- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF037D10- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF014E12- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF024P12- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF040P23- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF005O06- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
rJMFF001C23- GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
JMFN006P04+ GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
                      ____________________________________________________________
consensus GAGCACCCCGTGGTCCAAATTTCTCTTTGAAC-AAATGTATGGGCAGGAAACTCCTCCGA
 
. : . : . : . : . : . :
rJMFF044N10- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF029O09- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF006F19- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF011H05- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCANAT
rJMFF008A22- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF009E02- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF049G08- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF045M05- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF044C01- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF041N07- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF051G22- TGTATGTCTGCATGAAAACAGCATTGATTCC
rJMFF014E14- TGNATGTCTGCATGAAANCAGCATTGATTCCCACTGAAAGTGG
rJMFF003O21- TGTATGTCTGCATGAAAACANCATTGATTCCCA
JMFN005J23+ TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTG
rJMFF046P19- TGTATGTCTGCAT
rJMFF006A18- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF033E19- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF014C06- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF011N06- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF032O09- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF020H05- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF024L04- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF014E17- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF039N17- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF004M23- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF034I16- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF034M24- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF010M21- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF011J09- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF016B20- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF039A12- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF040J14- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF036B17- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF038M17- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF014J09- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF010A07- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF005P12- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF007F19- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF038O13- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF019A11- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF008C07- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF010N08- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF016N23- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCANAT
rJMFF039H13- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF035P14- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF039A19- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF005G14- TGTATGTCTGCATGAAAA-AGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF011D01- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF034C21- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF015A08- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF044C12- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF028C20- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCANAT
JMFN030N01+ TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF015A19- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCANAT
rJMFF050G16- TGTATGTCTGCATGANAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTT-ACCAGAT
rJMFF041B08- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF012G12- TGNATGNCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGNACCGTG
rJMFF001H18- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF021L09- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF008H05- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF037P22- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF033F05- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF005I18- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF006C11- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF014B12- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF037D10- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF014E12- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF024P12- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF040P23- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF005O06- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
rJMFF001C23- TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
JMFN006P04+ TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
                      ____________________________________________________________
consensus TGTATGTCTGCATGAAAACAGCATTGATTCCCACTGAAAGTGGACCGTGTTTAACCAGAT
 
. : . : . : . : . : . :
rJMFF044N10- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF029O09- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF006F19- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF011H05- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF008A22- TCGCAG-AATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF009E02- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF049G08- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF045M05- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF044C01- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCG
rJMFF041N07- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAA
rJMFF006A18- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF033E19- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF014C06- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF011N06- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF032O09- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF020H05- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF024L04- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF014E17- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF039N17- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF004M23- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF034I16- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF034M24- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF010M21- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF011J09- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF016B20- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF039A12- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF040J14- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF036B17- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF038M17- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF014J09- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF010A07- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF005P12- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF007F19- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF038O13- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF019A11- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF008C07- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF010N08- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF016N23- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF039H13- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF035P14- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF039A19- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF005G14- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF011D01- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF034C21- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF015A08- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF044C12- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF028C20- TCGCANCAATTTGATCTTCNTCAAGGGAGACTACGCTGAAGTTAGCAACAGCANCAGCGA
JMFN030N01+ TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF015A19- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGC
rJMFF050G16- TCGCAGCAATT
rJMFF041B08- TCGCAGCATTTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCACCAGCAGCAGCGA
rJMFF001H18- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF021L09- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF008H05- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF037P22- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF033F05- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF005I18- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF006C11- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF014B12- TCNCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF037D10- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF014E12- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF024P12- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF040P23- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF005O06- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
rJMFF001C23- TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
JMFN006P04+ TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
                      ____________________________________________________________
consensus TCGCAGCAATTTGATCTTCATCAAGGGAGACTACGCTGAAGTTAGCAACAGCAGCAGCGA
 
. : . : . : . : . : . :
rJMFF044N10- T
rJMFF029O09- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTANGGATAATCCTTTTCC
rJMFF006F19- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF011H05- TTTTGCTTTTATCAAACTTGCNAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF008A22- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF009E02- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-G
rJMFF049G08- TTTTGCTTTTATCAAACTTGC
rJMFF045M05- TTTTGCTTTTATC
rJMFF006A18- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF033E19- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF014C06- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF011N06- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF032O09- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF020H05- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF024L04- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF014E17- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF039N17- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTANGGATAATCCTTTTCC
rJMFF004M23- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF034I16- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF034M24- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCC
rJMFF010M21- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF011J09- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF016B20- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF039A12- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF040J14- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF036B17- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF038M17- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF014J09- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF010A07- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF005P12- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF007F19- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF038O13- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF019A11- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF008C07- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF010N08- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF016N23- TTTTGCTTTTATCAAACTTGCGAGTGCCATCCTTCCCA-GTGTANGGATAATCCTTTTCC
rJMFF039H13- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF035P14- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF039A19- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF005G14- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF011D01- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCAGGTGTAGGGATAATCCTTTTCC
rJMFF034C21- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF015A08- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA
rJMFF044C12- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA
rJMFF028C20- TTTTGCTTTTATCNAACTTGCAAGTGCCNTCCTTCCCA-GNGTAAGGATAATCCTTTTCC
JMFN030N01+ TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF041B08- TTTT
rJMFF001H18- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF021L09- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF008H05- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF037P22- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF033F05- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF005I18- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF006C11- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF014B12- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF037D10- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF014E12- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF024P12- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF040P23- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF005O06- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
rJMFF001C23- TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
JMFN006P04+ TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
                      ____________________________________________________________
consensus TTTTGCTTTTATCAAACTTGCAAGTGCCATCCTTCCCA-GTGTAGGGATAATCCTTTTCC
 
. : . : . : . : . : . :
rJMFF029O09- TTCTCAAGACCACCTGACTGGAGTACATACTC
rJMFF006F19- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCAGGTGGTCATCAATCCACCATT
rJMFF011H05- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF008A22- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF006A18- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF033E19- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF014C06- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF011N06- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF032O09- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF020H05- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF024L04- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF014E17- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF039N17- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF004M23- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF034I16- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF010M21- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF011J09- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF016B20- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF039A12- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF040J14- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF036B17- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF038M17- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF014J09- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF010A07- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF005P12- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF007F19- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF038O13- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF019A11- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF008C07- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF010N08- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF016N23- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF039H13- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF035P14- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAAT
rJMFF039A19- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-G
rJMFF005G14- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF011D01- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAAT
rJMFF034C21- TTCTCAAGACCACCTGACTGG
rJMFF028C20- TTCT
JMFN030N01+ TTCTCAAGACCACCTGACTGGA
rJMFF001H18- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF021L09- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF008H05- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF037P22- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF033F05- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCGCCATT
rJMFF005I18- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF006C11- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF014B12- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF037D10- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF014E12- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF024P12- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF040P23- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF005O06- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
rJMFF001C23- TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
JMFN006P04+ TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
JMFF047G19+ ACCACCTGACTGGAGTACATCCTCATACGCA-G-CGTCATCAATCCAGCATT
JMFS144B05+ TACATACTCATACGCA-GTGGTCATCAATCCACCATT
JMFF041B08+ CGCA-GTGGTCATCAATCCACCATT
JMFF041N07+ GTCATCAATCCACCATT
                      ____________________________________________________________
consensus TTCTCAAGACCACCTGACTGGAGTACATACTCATACGCA-GTGGTCATCAATCCACCATT
 
. : . : . : . : . : . :
rJMFF006F19- ACA
rJMFF011H05- ACACCCT-GAATCACATGCACCAGCTTCCTC
rJMFF008A22- ACACCCT-GAATCACATGCACCAG
rJMFF006A18- ACACCCT-GAATCACATGCACCAGCTTCCTCA
rJMFF033E19- ACACCCT-GAATCACATGCACCAGCTTCCTCAG
rJMFF014C06- ACACCCT-GAATCACATGCACCAGCTTCCTCAG
rJMFF011N06- ACACCCT-GAATCACATGCACCAGCTTCCTCAG
rJMFF032O09- ACACCCT-GAATCACATGCACCAGCTTCCTCAG
rJMFF020H05- ACACCCTGGAATCACATGCACCAGCTTCCTCAG
rJMFF024L04- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF014E17- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF039N17- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF004M23- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF034I16- ACACCCT-GAATCACATGCACCAACTTCCTCANGATCACAC-AAATGGTCGCAGTCCACA
rJMFF010M21- ACACCCT-GAATCACATGCACCAGCTTCCTCANGATCACAC-AAATGGTCGCAGTCCACA
rJMFF011J09- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACACAAAATGGTCGCAGTCCACA
rJMFF016B20- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACACAAAATGGTCGCAGTCCACN
rJMFF039A12- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGT
rJMFF040J14- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF036B17- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF038M17- ACACCCT-GAATCACATGCACCAGCTTCCTCAGG
rJMFF014J09- ACACCCT-GAATCACATGCACCAGCTTCCTCAGG
rJMFF010A07- ACACCCT-GAATCACATGCACCAGCTTCCTCA
rJMFF005P12- ACACCCT-GAATCACATGCACCAGCTTCCTCA
rJMFF007F19- ACACCCT-GAATCACATGCACCAGCTTCCTCA
rJMFF038O13- ACACCCT-GAATCACATGCACCAGCTTCCTCA
rJMFF019A11- ACACCCT-GAATCACATGCACCAGCTTCCT
rJMFF008C07- ACACCCT-GAATCACATGCACCAGCTTCCT
rJMFF010N08- ACACCCT-GAATCACATGCACCAGCTTCCTC
rJMFF016N23- ACANCCT-GAATCNCATGCACCAGCTTCCTCA
rJMFF039H13- ACACCCT-GAATCACATGCACCAGCTTCCT
rJMFF005G14- ACACCCT-GAATCACATGCACCAGCTTCCTCA
rJMFF001H18- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF021L09- ACACCCT-GAAACACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF008H05- ACACCCT-GAATCACATGCACCAGCTTCCTCANGATCACAC-AAATGGTCGCAGTCCACA
rJMFF037P22- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF033F05- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF005I18- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF006C11- ACACCCT-GAAACACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF014B12- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF037D10- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF014E12- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF024P12- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF040P23- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF005O06- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
rJMFF001C23- ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFN006P04+ ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF047G19+ TCAACCT-GTATCACATGCGCCAGCTTCGTCAGGATCACAC-AGATGGTGGCAGTCCACA
JMFS144B05+ ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF041B08+ ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF010M21+ TCACATGCACCAGCTTCNTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF047L07+ CAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFS037D03+ CAGCTTCCTCAGGATCACAC-ANATGGTCGCAGTCCACA
JMFF032O09+ AATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF011N06+ GAATCACATGCACCAGCTTCNTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF008A22+ TCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF044C01+ CAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF033E19+ T-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF040P23+ CAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF038M17+ AGGATCACAC-AAATGGTCGCAGTCCACA
JMFF045M05+ CAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF045C19+ GGATCACAC-AAATGGTCGCAGTCCACA
JMFF051G22+ C-AAATGGTCGCAGTCCACA
JMFS163H05+ TCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFN036C04+ CAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF016N23+ ACA
JMFF034I16+ CA
JMFF037P22+ TCCACA
JMFF049G08+ CA
JMFF003E22+ TCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFS062D04+ T-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF019A11+ AGGATCACAC-AAATGGTCGCAGTCCACA
JMFN019P20+ GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF044N10+ CAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF011H05+ ACA
JMFF050G16+ C-AAATGGTCGCAGTCCACA
JMFF041N07+ ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
JMFF015A08+ CA
JMFF044C12+ CAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
                      ____________________________________________________________
consensus ACACCCT-GAATCACATGCACCAGCTTCCTCAGGATCACAC-AAATGGTCGCAGTCCACA
 
. : . : . : . : . : . :
rJMFF024L04- AGCTGCTGCTCACT
rJMFF014E17- AGCTGCTGCTCACTGA
rJMFF039N17- AGCTGCTGCTCAC
rJMFF004M23- AGCTGCTGCTCACTGA
rJMFF034I16- AGCTGCTGCTCACTGA
rJMFF010M21- AGCTGCTGCTCACTGA
rJMFF011J09- AGCTGCTGCTCA
rJMFF016B20- AGCTGCTGCTCAC
rJMFF040J14- AGCTGCTGCTCAC
rJMFF036B17- AGCTGCTGCTCACT
rJMFF001H18- AGCTGCTGCTCACTGA
rJMFF021L09- AGCTGCTGCTCACTGA
rJMFF008H05- AGCTGCTGCTCACTGAG
rJMFF037P22- AGCTGCTGCTCACTGA
rJMFF033F05- AGCTGCTGCTCACTGA
rJMFF005I18- AGCTGCTGCTCACTGAG
rJMFF006C11- AGCTGCTGCTCACTGAGG
rJMFF014B12- AGCTGCTGCTCACTGAGGCTCACTAGCT
rJMFF037D10- AGCTGCTGCTCACTGANGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TT
rJMFF014E12- AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
rJMFF024P12- AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
rJMFF040P23- AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
rJMFF005O06- AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
rJMFF001C23- AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFN006P04+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF047G19+ AGCTGCTGCTCACTGAGGCTCACTAGCTCTCCGGTCGCCAGAAAATTTGCTCC-TTCCAG
JMFS144B05+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF041B08+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF010M21+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF047L07+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFS037D03+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF032O09+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF011N06+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF008A22+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF044C01+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF033E19+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF040P23+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF038M17+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF045M05+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF045C19+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF051G22+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFS163H05+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFN036C04+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF016N23+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF034I16+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF037P22+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF049G08+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF034M24+ TGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF020H05+ AGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF012G12+ CTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFS163G08+ GCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF039A19+ CTAGCTCACCGGTCGCCAGAAAATTTGCTTC-TTCCAA
JMFF016B20+ TAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF010N08+ TAGCTCACCGGTCGCCAGAAAATTTGCTCN-TTCCAA
JMFF009E02+ CCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF036B17+ GTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF014C06+ CCAGAAAATTTGCTCC-TTCCAA
JMFF039N17+ TTCCAA
JMFF033F05+ TCCAA
JMFF035P14+ CAA
JMFF003E22+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFS062D04+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF019A11+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFN019P20+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF044N10+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF011H05+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF050G16+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAA-TTGCTCCCTTCCAA
JMFF046P19+ GAGGCTCACTAGCTCACCGGTCGCCAGAAAA-TTGCTCCTTTCCAA
JMFF028C20+ TCCAA
JMFF018L14+ GTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF041N07+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF015A08+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF044C12+ AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF014J09+ GCCAGAAAATTTGCTCC-TTCCAA
JMFF006C11+ TCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
JMFF011J09+ CGCCAGAAAATTTGCTCN-TTCCAA
                      ____________________________________________________________
consensus AGCTGCTGCTCACTGAGGCTCACTAGCTCACCGGTCGCCAGAAAATTTGCTCC-TTCCAA
 
. : . : . : . : . : . :
rJMFF014E12- CGCTCCC
rJMFF024P12- CGCTCCCG
rJMFF040P23- CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGG
rJMFF005O06- CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGG
rJMFF001C23- CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFN006P04+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF047G19+ CGCTCCCGTGGTACTAAGCGACCACCTCCTTCCACATGAACCTCGATCCTTTACGCCGGT
JMFS144B05+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF041B08+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAGCCCTGATCCTTTACGCCGGT
JMFF010M21+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF047L07+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFS037D03+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF032O09+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF011N06+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF008A22+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF044C01+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF033E19+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF040P23+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF038M17+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF045M05+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF045C19+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF051G22+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFS163H05+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFN036C04+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF016N23+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF034I16+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF037P22+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF049G08+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF034M24+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF020H05+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF012G12+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFS163G08+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF039A19+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF016B20+ CGCTCCCGTGGTANTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF010N08+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF009E02+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF036B17+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF014C06+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF039N17+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF033F05+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF035P14+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF011D01+ GTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF003E22+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFS062D04+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF019A11+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFN019P20+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF044N10+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF011H05+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF050G16+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF046P19+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTNTACGCCGGT
JMFF028C20+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF018L14+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF041N07+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCATTTACGCCGGT
JMFF015A08+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCATTTACGCCGGT
JMFF044C12+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF014J09+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF006C11+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF004M23+ GGTANTAAACGACCAGCACGATCCACATGAACCNTGATCCTTTACGCCGGT
JMFF011J09+ CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF006A18+ GGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF021L09+ TAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF010A07+ TAAACGACCAGCACGATCCACATGAACCNTGATCCTTTACGCCGGT
JMFF014E17+ CTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF008H05+ CTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF006F19+ CTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
JMFF037D10+ CCTTTACGCCGGT
JMFF049A01+ TGATCCTTTACGCCGGT
JMFF024P12+ CTTTACGCCGGT
JMFF007F19+ CTTTACGCCGGT
JMFF008C07+ CTTTACGCCGGT
JMFF014B12+ CTTTACGCCGGT
JMFF039H13+ TTACGCCGGT
JMFF005I18+ TACGCCGGT
JMFF005O06+ ACGCCGGT
JMFF005G14+ CTTTACGCCGGT
JMFF005P12+ CTTTACGCCGGT
JMFF047M04+ ACGCCGGT
JMFF024L04+ GGT
JMFF001H18+ CTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
                      ____________________________________________________________
consensus CGCTCCCGTGGTACTAAACGACCAGCACGATCCACATGAACCCTGATCCTTTACGCCGGT
 
. : . : . : . : . : . :
rJMFF001C23- TACGGCACCATAGTCACGCCAGTCGA
JMFN006P04+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF047G19+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTGCGTCGGGAGCATCT
JMFS144B05+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF041B08+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF010M21+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF047L07+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFS037D03+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF032O09+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF011N06+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF008A22+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF044C01+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF033E19+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF040P23+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF038M17+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF045M05+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF045C19+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF051G22+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFS163H05+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFN036C04+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF016N23+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF034I16+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF037P22+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF049G08+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF034M24+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF020H05+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF047A16+ AGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF012G12+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFS163G08+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF039A19+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF016B20+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF010N08+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF009E02+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF036B17+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF014C06+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF039N17+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF033F05+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF035P14+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF011D01+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF003E22+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFS062D04+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF019A11+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFN019P20+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF044N10+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF011H05+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF050G16+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF046P19+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF028C20+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF018L14+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF041N07+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGTTG-GTCGGGAGGATCT
JMFF015A08+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGTTG-GTCGGGAGGATCT
JMFF044C12+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF014J09+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF006C11+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF004M23+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF011J09+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF006A18+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF021L09+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF010A07+ TACGGCACCATAGTCACGCCAGTNGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF014E17+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF008H05+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF006F19+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF037D10+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF049A01+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF024P12+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF007F19+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF008C07+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF014B12+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF039H13+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF005I18+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF005O06+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF005G14+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF005P12+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF047M04+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF024L04+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF048K02+ GAGGGGAGATCGCTG-GTCGGGAGGATCT
JMFF001H18+ TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
                      ____________________________________________________________
consensus TACGGCACCATAGTCACGCCAGTCGAAGTCGGAGGGGAGATCGCTG-GTCGGGAGGATCT
 
. : . : . : . : . : . :
JMFN006P04+ CAGCCGCATGAGCATCGGCTGGGAGCTTGA
JMFF047G19+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCGTG
JMFS144B05+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF041B08+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF010M21+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF047L07+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFS037D03+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF032O09+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF011N06+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF008A22+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF044C01+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF033E19+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF040P23+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF038M17+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF045M05+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF045C19+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF051G22+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFS163H05+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFN036C04+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF016N23+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF034I16+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF037P22+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF049G08+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF034M24+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF020H05+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF047A16+ CAGCCGCATGAGCATCGGCTGGGAGC-TGAGCTTTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF012G12+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFS163G08+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF039A19+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF016B20+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF010N08+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF009E02+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF036B17+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF014C06+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF039N17+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF033F05+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF035P14+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF011D01+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF003E22+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFS062D04+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF019A11+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFN019P20+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF044N10+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF011H05+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF050G16+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF046P19+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF028C20+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF018L14+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF041N07+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF015A08+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF044C12+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF014J09+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF006C11+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF004M23+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF011J09+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF006A18+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF021L09+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF010A07+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF014E17+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF008H05+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF006F19+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF037D10+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF049A01+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF024P12+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF007F19+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF008C07+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF014B12+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF039H13+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF005I18+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF005O06+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF005G14+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-ATCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF005P12+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCCTTTCCTG
JMFF047M04+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF024L04+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF048K02+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF049A12+ GCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF003O21+ CATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
JMFF029O09+ TG
JMFF001H18+ CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
                      ____________________________________________________________
consensus CAGCCGCATGAGCATCGGCTGGGAGCTTGAGC-TTCCGCTTGCCGGAGCTGCTTTTCCTG
 
. : . : . : . : . : . :
JMFF047G19+ ATTCCGAGGAAGCTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGATCTTCGTGACC-CC
JMFS144B05+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF041B08+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF010M21+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF047L07+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFS037D03+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF032O09+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF011N06+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF008A22+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF044C01+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF033E19+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF040P23+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF038M17+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF045M05+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF045C19+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF051G22+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFS163H05+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFN036C04+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF016N23+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF034I16+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF037P22+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACGNCC
JMFF049G08+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF034M24+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF020H05+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF047A16+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF012G12+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFS163G08+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF039A19+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF016B20+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF010N08+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF009E02+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF036B17+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF014C06+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF039N17+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF033F05+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF035P14+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF011D01+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF003E22+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFS062D04+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF019A11+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFN019P20+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTAGTGACG-CC
JMFF044N10+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF011H05+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF050G16+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF046P19+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF028C20+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF018L14+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF041N07+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF015A08+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF044C12+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF014J09+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF006C11+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF004M23+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF011J09+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF006A18+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF021L09+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF010A07+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF014E17+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF008H05+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF006F19+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF037D10+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF049A01+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF024P12+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF007F19+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF008C07+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF014B12+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF039H13+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF005I18+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF005O06+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF005G14+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF005P12+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF047M04+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF024L04+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF048K02+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF049A12+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF003O21+ ATTCCGAGGAAGNTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF003P11+ GAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF001C23+ GAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
JMFF029O09+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGANCTTCGTGACG-CC
JMFF001H18+ ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
                      ____________________________________________________________
consensus ATTCCGAGGAAGGTCCGCCGAAACTCCTTAGGAGTGAGATCGGAGAACTTCGTGACG-CC
 
. : . : . : . : . : . :
JMFF047G19+ GTGGCCGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGTCGCAAGTTACCCTTGAA
JMFS144B05+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF041B08+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF010M21+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF047L07+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFS037D03+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF032O09+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF011N06+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF008A22+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF044C01+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF033E19+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF040P23+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF038M17+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF045M05+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF045C19+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF051G22+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFS163H05+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFN036C04+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF016N23+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF034I16+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF037P22+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF049G08+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF034M24+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF020H05+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF047A16+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGTTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF012G12+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGTTTAGCACGGCGCAAGTTAGCCTTGAA
JMFS163G08+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF039A19+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF016B20+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF010N08+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF009E02+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF036B17+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF014C06+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF039N17+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF033F05+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF035P14+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF011D01+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF003E22+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFS062D04+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF019A11+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFN019P20+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF044N10+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF011H05+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF050G16+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF046P19+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF028C20+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF018L14+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF041N07+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF015A08+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF044C12+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF014J09+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF006C11+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF004M23+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF011J09+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF006A18+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF021L09+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF010A07+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF014E17+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF008H05+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF006F19+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF037D10+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF049A01+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF024P12+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF007F19+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF008C07+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF014B12+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF039H13+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF005I18+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF005O06+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF005G14+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF005P12+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF047M04+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF024L04+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF048K02+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF049A12+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF003O21+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF003P11+ GTGGNCGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF048J19+ CCTTGAA
JMFF001C23+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
JMFF029O09+ GTGGACGGCGGAGGGGTCCANCAGCTGGTGGCGCTTAGCACGGCGCAAGTTACCCTNGAA
JMFF001H18+ GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
                      ____________________________________________________________
consensus GTGGACGGCGGAGGGGTCCAGCAGCTGGTGGCGCTTAGCACGGCGCAAGTTAGCCTTGAA
 
. : . : . : . : . : . :
JMFF047G19+ GACGGAGAGCCTGTAGTCGTCC-TCCTCGTGCGTCGCGTAGCTCTTCCCGTA
JMFS144B05+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF041B08+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF010M21+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF047L07+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFS037D03+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF032O09+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF011N06+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF008A22+ GACGGAGAGCCTGTAGTCGTGC-TCCTCTTGCGTCGCGTTACTCTTCCCGTACTTGGACT
JMFF044C01+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF033E19+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTA---GGACT
JMFF040P23+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF038M17+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF045M05+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF045C19+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF051G22+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFS163H05+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFN036C04+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF016N23+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF034I16+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF037P22+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF049G08+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF034M24+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF020H05+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF047A16+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF012G12+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFS163G08+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF039A19+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF016B20+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF010N08+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF009E02+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF036B17+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF014C06+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF039N17+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF033F05+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF035P14+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF011D01+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF003E22+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFS062D04+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF019A11+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFN019P20+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF044N10+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF011H05+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF050G16+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF046P19+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF028C20+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF018L14+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF041N07+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF015A08+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF044C12+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF014J09+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF006C11+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF004M23+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF011J09+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF006A18+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF021L09+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF010A07+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF014E17+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF008H05+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF006F19+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF037D10+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF049A01+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF024P12+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF007F19+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF008C07+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF014B12+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF039H13+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF005I18+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF005O06+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF005G14+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF005P12+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF047M04+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF024L04+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF048K02+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCGCCCCGTACTTGGACT
JMFF049A12+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF003O21+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF003P11+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF048J19+ GACGGAGAGCCTGTAGTCGTGCTTCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF001C23+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF029O09+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
JMFF001H18+ GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
                      ____________________________________________________________
consensus GACGGAGAGCCTGTAGTCGTGC-TCCTCCTGCGTCGCGTAGCTCTTCCCGTACTTGGACT
 
. : . : . : . : . : . :
JMFS144B05+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF041B08+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF010M21+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF047L07+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFS037D03+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF032O09+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF011N06+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF008A22+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF044C01+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF033E19+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF040P23+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF038M17+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF045M05+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF045C19+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF051G22+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFS163H05+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFN036C04+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF016N23+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF034I16+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF037P22+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF049G08+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF034M24+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF020H05+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF047A16+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF012G12+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFS163G08+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF039A19+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF016B20+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF010N08+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF009E02+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF036B17+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF014C06+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF039N17+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF033F05+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF035P14+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF011D01+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF003E22+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFS062D04+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF019A11+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFN019P20+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF044N10+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF011H05+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF050G16+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF046P19+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF028C20+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF018L14+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF041N07+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF015A08+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF044C12+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF014J09+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF006C11+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF004M23+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF011J09+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF006A18+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF021L09+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF010A07+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF014E17+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF008H05+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF006F19+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF037D10+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF049A01+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF024P12+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF007F19+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF008C07+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF014B12+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF039H13+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF005I18+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF005O06+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF005G14+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF005P12+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF047M04+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF024L04+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF048K02+ TGAACTGCGTGTAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF049A12+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF003O21+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF003P11+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF048J19+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF001C23+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
JMFF029O09+ TGAACAGCGTGAAGTGATGGTCGGCGTNGAGCAGAGCATCGTCCTCGCCGTCCGACACGN
JMFF001H18+ TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
                      ____________________________________________________________
consensus TGAACAGCGTGAAGTGATGGTCGGCGTTGAGCAGAGCATCGTCCTCGCCGTCCGACACG-
 
. : . : . : . : . : . :
JMFS144B05+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGA
JMFF041B08+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF010M21+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF047L07+ ACCTGCCGGTATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFS037D03+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF032O09+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF011N06+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF008A22+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF044C01+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF033E19+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF040P23+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF038M17+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF045M05+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF045C19+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF051G22+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFS163H05+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFN036C04+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF016N23+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF034I16+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF037P22+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF049G08+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF034M24+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF020H05+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF047A16+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF012G12+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFS163G08+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF039A19+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF016B20+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF010N08+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF009E02+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF036B17+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF014C06+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF039N17+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF033F05+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF035P14+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF011D01+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF003E22+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFS062D04+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF019A11+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFN019P20+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF044N10+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF011H05+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF050G16+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF046P19+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF028C20+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF018L14+ ACCTGCCGG-ATCAAC
JMFF041N07+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF015A08+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF044C12+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF014J09+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF006C11+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF004M23+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF011J09+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF006A18+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF021L09+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF010A07+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF014E17+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF008H05+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF006F19+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF037D10+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF049A01+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF024P12+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF007F19+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF008C07+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF014B12+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF039H13+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF005I18+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF005O06+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF005G14+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF005P12+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF047M04+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF024L04+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF048K02+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF049A12+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF003O21+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF003P11+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF048J19+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF001C23+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF029O09+ NCCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
JMFF001H18+ ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
                      ____________________________________________________________
consensus ACCTGCCGG-ATCAACGGATCCTCATCGGCGCGCACGACGCACGCCGCCGTTAAGGCGAG
 
. : . : . : . : . : . :
JMFF041B08+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF010M21+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF047L07+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFS037D03+ TATCAGTAGGGAGAGGAGAGAAAA
JMFF032O09+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF011N06+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF008A22+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF044C01+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF033E19+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF040P23+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF038M17+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF045M05+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF045C19+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF051G22+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFS163H05+ TATCAGTAGGGAGAGGAGAGAAAA
JMFN036C04+ TATCAGTAGGGAGAGGAGA
JMFF016N23+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF034I16+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF037P22+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF049G08+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF034M24+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF020H05+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF047A16+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF012G12+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFS163G08+ TATCAGTAGGGAGAGGAGAGAAAA
JMFF039A19+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF016B20+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF010N08+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF009E02+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF036B17+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF014C06+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF039N17+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF033F05+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF035P14+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF011D01+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF003E22+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFS062D04+ TATCAGTAGGGAGAGGAGAGAAAA
JMFF019A11+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFN019P20+ TATCAGTAGGGAGAGGAGAGAAAACC
JMFF044N10+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF011H05+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF050G16+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF046P19+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF028C20+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF041N07+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATAT
JMFF015A08+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATAT
JMFF044C12+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTTTTTT
JMFF014J09+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTTTTTTAC
JMFF006C11+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTTTTTTAC
JMFF004M23+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF011J09+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTTTTTTACT
JMFF006A18+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTTTTTTACT
JMFF021L09+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTTTTTTAC
JMFF010A07+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTTTTTTACT
JMFF014E17+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF008H05+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF006F19+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAA
JMFF037D10+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTT
JMFF049A01+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF024P12+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF007F19+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF008C07+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF014B12+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF039H13+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF005I18+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF005O06+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF005G14+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAG
JMFF005P12+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF047M04+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF024L04+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF048K02+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTTTTTTACT
JMFF049A12+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF003O21+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF003P11+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF048J19+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGA
JMFF001C23+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF029O09+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGAT
JMFF001H18+ TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTTTTTTACTGT
                      ____________________________________________________________
consensus TATCAGTAGGGAGAGGAGAGAAAACCGATCCATCGGAGAGAAGATATTTTTTTTTACTGT