Previous Contig 000021:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H11Sequence501000021 (5)pir|C86186|C861861e-42hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889541 Arabid719000021 (5)pir|C86186|C861862e-85hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889541 Arabid
JMFN038P20Sequence602000021 (5)pir|C86186|C861861e-53hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889541 Arabid
JMSF034K10Sequence662000021 (5)pir|C86186|C861861e-71hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889541 Arabid723000021 (5)pir|C86186|C861867e-85hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889541 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF001H11- AAAATTGAGGGTGTTGTTAA
rJMSF034K10- AATTGAGGGTGTTGTTAA
                      ____________________________________________________________
consensus AAAATTGAGGGTGTTGTTAA
 
. : . : . : . : . : . :
rJMFF001H11- TGCACATCACATGATATACATACATTGAACAAGGGAAAACAACTAACAATGACAGGTAAG
rJMSF034K10- TGCACATCACATGATATACATACATTGAACAAGGGAAAACAACTAACAATGACAGGTAAG
                      ____________________________________________________________
consensus TGCACATCACATGATATACATACATTGAACAAGGGAAAACAACTAACAATGACAGGTAAG
 
. : . : . : . : . : . :
rJMFF001H11- TTATCACTTCTTCTTTCCAGCTTTACCCTCCTTTCTTCTAATAACTTCATCGGCATACTT
rJMSF034K10- TTATCACTTCTTCTTTCCAGCTTTACCCTCCTTTCTTCTAATAACTTCATCGGCATACTT
                      ____________________________________________________________
consensus TTATCACTTCTTCTTTCCAGCTTTACCCTCCTTTCTTCTAATAACTTCATCGGCATACTT
 
. : . : . : . : . : . :
rJMFF001H11- CACACCCTTACCTTTATACGGCTCCGGAGGCCTCCATTTCCTAATCGAGGCAGCAAACTG
rJMSF034K10- CACACCCTTACCTTTATACGGCTCCGGAGGCCTCCATTTCCTAATCGAGGCAGCAAACTG
JMSF034K10+ AATCGAGGCAGCAAACTG
                      ____________________________________________________________
consensus CACACCCTTACCTTTATACGGCTCCGGAGGCCTCCATTTCCTAATCGAGGCAGCAAACTG
 
. : . : . : . : . : . :
rJMFF001H11- ACCGATGGCAGATTTATCGTATCCACTCACAGTGATTCTAGTGTTCTCTTCAACCTTAAC
rJMSF034K10- ACCGATGGCAGATTTATCGTATCCACTCACAGTGATTCTAGTGTTCTCTTCAACCTTAAC
JMSF034K10+ ACCGATGGCAGATTTATCGTATCCACTCACAGTGATTCTAGTGTTCTCTTCAACCTTAAC
JMFN038P20+ TAAC
                      ____________________________________________________________
consensus ACCGATGGCAGATTTATCGTATCCACTCACAGTGATTCTAGTGTTCTCTTCAACCTTAAC
 
. : . : . : . : . : . :
rJMFF001H11- CTGCAAGCCATCAGGGATTGCCATCCGAACCGGATGAGAGAATCCGAGATTAAGAACTAT
rJMSF034K10- CTGCAAGCCATCAGGGATTGCCATCCGAACCGGATGAGAGAATCCGAGATTAAGAACTAT
JMSF034K10+ CTGCAAGCCATCAGGGATTGCCATCCGAACCGGATGAGAGAATCCGAGATTAAGAACTAT
JMFN038P20+ CTGCAAGCCATCAGGGATTGCCATCCGAACCGGATGAGAGAATCCGAGATTAAGAACTAT
                      ____________________________________________________________
consensus CTGCAAGCCATCAGGGATTGCCATCCGAACCGGATGAGAGAATCCGAGATTAAGAACTAT
 
. : . : . : . : . : . :
rJMFF001H11- ATCTTTGCCTTCAACCATCGCACGGTACCCTACACCAACCAACTGCAGTTTCTTGTCAAA
rJMSF034K10- ATCTTTGCCTTCAACCATCGCACGGTACCCTACACCAACCAACTGCAGTTTCTTGTCAAA
JMSF034K10+ ATCTTTGCCTTCAACCATCGCACGGTACCCTACACCAACCAACTGCAGTTTCTTGTCAAA
JMFN038P20+ ATCTTTGCCTTCAACCATCGCACGGTACCCTACACCAACCAACTGCAGTTTCTTGTCAAA
JMFF001H11+ CCAACTGCAGTTTCTTGTCAAA
                      ____________________________________________________________
consensus ATCTTTGCCTTCAACCATCGCACGGTACCCTACACCAACCAACTGCAGTTTCTTGTCAAA
 
. : . : . : . : . : . :
rJMFF001H11- CCCCTTAGATACGCCTACAATCATGTTGTCGGTGAGGGTCCTGAATAAACCATGCATCTC
rJMSF034K10- CCCCTTAGATACGCCTACAATCATGTTGTCGGTGAGGGTCCTGAATAAACCATGCATCTC
JMSF034K10+ CCCCTTAGATACGCCTACAATCATGTTGTCGGTGAGGGTCCTGAATAAACCATGCATCTC
JMFN038P20+ CCCCTTAGATACGCCTACAATCATGTTGTCGGTGAGGGTCCTGAATAAACCATGCATCTC
JMFF001H11+ CCCCTTAGATACGCCTACAATCATGTTGTCGGTGAGGGTCCTGAATAAACCATGCATCTC
                      ____________________________________________________________
consensus CCCCTTAGATACGCCTACAATCATGTTGTCGGTGAGGGTCCTGAATAAACCATGCATCTC
 
. : . : . : . : . : . :
rJMFF001H11- GTTAGC-CCGTCTCGTCTCCATAGCCTTTCTGACCCTAAGCACTCCCGATTCCTCCTTCT
rJMSF034K10- GTTAGC-CCGTCTCGTCTCCATAGCCTTTCTGACCCTAAGCACTCCCGATTCCTCCTTCT
JMSF034K10+ GTTAGC-CCGTCTCGTCTCCATAGCCTTTCTGACCCTAAGCACTCCCGATTCCTCCTTCT
JMFN038P20+ GTTAGCTCCGTCTCGTCTCCATAGCCTTTCTGACCCTAAGCACTCCCGATTCCTCCTTCT
JMFF001H11+ GTTAGC-CCGTCTCGTCTCCATAGCCTTTCTGACCCTAAGCACTCCCGATTCCTCCTTCT
                      ____________________________________________________________
consensus GTTAGC-CCGTCTCGTCTCCATAGCCTTTCTGACCCTAAGCACTCCCGATTCCTCCTTCT
 
. : . : . : . : . : . :
rJMFF001H11- CTAGCTTTACCTCTCGTGGATAAGTAATACCCAACTCTCCTAGAGGACCTTTAACTTTGA
rJMSF034K10- CTAGCTTTACCTCTCGTGGATAAGTAATACCCAACTCTCCTAGAGGACCTTTAACTTTGA
JMSF034K10+ CTAGCTTTACCTCTCGTGGATAAGTAATACCCAACTCTCCTAGAGGACCTTTAACTTTGA
JMFN038P20+ CTAGCTTTACCTCTCGTGGATAAGTAATACCCAACTCTCCTAGAGGACCTTTAACTTTGA
JMFF001H11+ CTAGCTTTACCTCTCGTGGATAAGTAATACCCAACTCTCCTAGAGGACCTTTAACTTTGA
                      ____________________________________________________________
consensus CTAGCTTTACCTCTCGTGGATAAGTAATACCCAACTCTCCTAGAGGACCTTTAACTTTGA
 
. : . : . : . : . : . :
rJMFF001H11- AATCTTGTCCTTCCATTTTGATTGTCACATTGGAAGGCACTGGAATTGGTTGCTTACCAA
rJMSF034K10- AATCTTGTCCTTCCATTTTGATTGTCACATTGGAAGGCACTGGAATTGGTTGCTTACCAA
JMSF034K10+ AATCTTGTCCTTCCATTTTGATTGTCACATTGGAAGGCACTGGAATTGGTTGCTTACCAA
JMFN038P20+ AATCTTGTCCTTCCATTTTGATTGTCACATTGGAAGGCACTGGAATTGGTTGCTTACCAA
JMFF001H11+ AATCTTGTCCTTCCATTTTGATTGTCACATTGGAAGGCACTGGAATTGGTTGCTTACCAA
                      ____________________________________________________________
consensus AATCTTGTCCTTCCATTTTGATTGTCACATTGGAAGGCACTGGAATTGGTTGCTTACCAA
 
. : . : . : . : . : . :
rJMFF001H11- TTCTTGATTCCTTGCATTCCACCGTTTTCCTTACAAAGTTGTTGCGAGCAATGGTGAGCT
rJMSF034K10- TTCTTGATTCCTTGCATTCCACCGTTTTCCTTACAAAGTTGTTGCGAGCANTGGTGAGCT
JMSF034K10+ TTCTTGATTCCTTGCATTCCACCGTTTTCCTTACAAAGTTGTTGCGAGCAATGGTGAGCT
JMFN038P20+ TTCTTGATTCCTTGCATTCCACCGTTTTCCTTACAAAGTTGTTGCGAGCAATGGTGAGCT
JMFF001H11+ TTCTTGATTCCTTGCATTCCACCGTTTTCCTTACAAAGTTGTTGCGAGCAATGGTGAGCT
                      ____________________________________________________________
consensus TTCTTGATTCCTTGCATTCCACCGTTTTCCTTACAAAGTTGTTGCGAGCAATGGTGAGCT
 
. : . : . : . : . : . :
rJMFF001H11- TAAAGAAACGGATTCCACTAGCATCACCAATGAAATTAGA
rJMSF034K10- TAAAGAAACGGATTCCACTAGCATCACC-ATGAAATTAGACCTTAGG
JMSF034K10+ TAAAGAAACGGATTCCACTAGCATCACCAATGAAATTAGACCTTAGGTTGCTTGTTGCAA
JMFN038P20+ TAAAGAAACGGATTCCACTAGCATCACCAATGAAATTAGACCTTAGGTTGCTTGTTGCAA
JMFF001H11+ TAAAGAAACGGATTCCACTAGCATCACCAATGAAATTAGACCTTAGGTTGCTTGTTGCAA
                      ____________________________________________________________
consensus TAAAGAAACGGATTCCACTAGCATCACCAATGAAATTAGACCTTAGGTTGCTTGTTGCAA
 
. : . : . : . : . : . :
JMSF034K10+ AGGTTTTCTTGCGCTGAGTTGTCCCTGCAGATGAAGAAAACCCAAGGGCGGACACTGATG
JMFN038P20+ AGGTTTTCTTGCGCTGAGTTGTCCCTGCAGATGAAGAAAACCCAAGGGCGGACACTGATG
JMFF001H11+ AGGTTTTCTTGCGCTGAGTTGTCCCTGCAGATGAAGAAAACCCAAGGGCGGACACTGATG
                      ____________________________________________________________
consensus AGGTTTTCTTGCGCTGAGTTGTCCCTGCAGATGAAGAAAACCCAAGGGCGGACACTGATG
 
. : . : . : . : . : . :
JMSF034K10+ AGGAGAGTGTTGCTACTCTCTCCATTGCAAGAAAATGGAGGTTC
JMFN038P20+ AGGAGAGTGTTGCTACTCTCTCCATTGCAAGAAAATGGAGGTTCAAGAGAGAAAGCAA
JMFF001H11+ AGGAGAGTGTTGCTACTCTCTCCATTGCAAGAAAATGGAGGTTCAAGAGAGAAAGCAAGT
                      ____________________________________________________________
consensus AGGAGAGTGTTGCTACTCTCTCCATTGCAAGAAAATGGAGGTTCAAGAGAGAAAGCAAGT