Previous Contig 000020:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H04Sequence137000020 (2)gb:AF326117_17866200.011Capsicum annuum sesquiterpene cyclase (PSC2) mRNA, complete cds.827008182 (2)gb:AB023816_15156431e-66Solanum tuberosum PVS4 mRNA for vetispiradiene synthase, complete cds.
JMFF022H05Sequence490000020 (2)gb:AF484125_18040569e-41Nicotiana attenuata 5-epi-aristolochene synthase 37 mRNA, complete cds.773008182 (2)gb:AB023816_15156431e-59Solanum tuberosum PVS4 mRNA for vetispiradiene synthase, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF022H05+ CTCGTACAAA
                      ____________________________________________________________
consensus CTCGTACAAA
 
. : . : . : . : . : . :
JMFF022H05+ TTCAATAAACCCTTGACATCTTTAGAAAGAGTGTGTTTGAATTTTCCATGCTCTTGAAAA
                      ____________________________________________________________
consensus TTCAATAAACCCTTGACATCTTTAGAAAGAGTGTGTTTGAATTTTCCATGCTCTTGAAAA
 
. : . : . : . : . : . :
JMFF022H05+ TTTTTAAAGATTCCTGAAGGGATGTTGTAGCTATGTTGCCTTAGCAATCGGAACATAAGT
                      ____________________________________________________________
consensus TTTTTAAAGATTCCTGAAGGGATGTTGTAGCTATGTTGCCTTAGCAATCGGAACATAAGT
 
. : . : . : . : . : . :
JMFF022H05+ GCAGAAGTGCACAAATCATCTCCTAGCTCGAAATCAGGAATGGAATTGTAAATCACTTCC
                      ____________________________________________________________
consensus GCAGAAGTGCACAAATCATCTCCTAGCTCGAAATCAGGAATGGAATTGTAAATCACTTCC
 
. : . : . : . : . : . :
JMFF022H05+ AACATTTCATCAATCTCTTCATTGAAGTGATGCGAAATGCCGAGACGTTCAATGACGTCA
                      ____________________________________________________________
consensus AACATTTCATCAATCTCTTCATTGAAGTGATGCGAAATGCCGAGACGTTCAATGACGTCA
 
. : . : . : . : . : . :
JMFF022H05+ ATAAAATTGAGCTTCTCGAACAGTTTAGAGCTCCTAATATTGGTCAGCATGCTCCTCACT
                      ____________________________________________________________
consensus ATAAAATTGAGCTTCTCGAACAGTTTAGAGCTCCTAATATTGGTCAGCATGCTCCTCACT
 
. : . : . : . : . : . :
JMFF022H05+ CTTCCTTTTAACAGCTCAATCTCCTGAGCATACCTTTCTGCAACTTCGTCATCAAAGACA
JMFF001H04+ CTTCGTCATCAAAGACA
                      ____________________________________________________________
consensus CTTCCTTTTAACAGCTCAATCTCCTGAGCATACCTTTCTGCAACTTCGTCATCAAAGACA
 
. : . : . : . : . : . :
JMFF022H05+ AAGTGCCCGAATTGGTCTCCCCAAATGCTTGGGCAGAAGTTTGCGACGGGACGGACAAAC
JMFF001H04+ AAGTGCCCGAATTGGTCTCCCCAAATGCTTGGGCAGAAGTTTGCGACGGGACGGACAAAC
                      ____________________________________________________________
consensus AAGTGCCCGAATTGGTCTCCCCAAATGCTTGGGCAGAAGTTTGCGACGGGACGGACAAAC
 
. : . : . : . : . : . :
JMFF022H05+ TCGTTGCTTGTTGCCATTTGTTTTTTCTTTTGCGAGTTTAGTTTCTTGTTGGAGTAATGA
JMFF001H04+ TCGTTGCTTGTTGCCATTTGTTTTTTCTTNTGCGAGTNTAGTTTNTTGTTGGAGTAATGA
                      ____________________________________________________________
consensus TCGTTGCTTGTTGCCATTTGTTTTTTCTTTTGCGAGTTTAGTTTCTTGTTGGAGTAATGA