Previous Contig 000019:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H02Sequence490000019 (14)gb:AB016061_15127541e-22Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF003L09Sequence585000019 (14)gb:AB016061_15127541e-63Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.796012197 (11)gb:AB016061_15127543e-94Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF003N15Sequence493000019 (14)gb:AB016061_15127549e-42Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.678008293 (3)gb:AB016061_15127544e-57Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF004B01Sequence195000019 (14)813012197 (11)gb:AB016061_15127548e-96Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF017C13Sequence550000019 (14)gb:AB016061_15127544e-50Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.753012197 (11)gb:AB016061_15127547e-82Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF024F23Sequence551000019 (14)gb:AB016061_15127542e-31Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.728012197 (11)gb:AB016061_15127541e-81Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF025P22Sequence555000019 (14)gb:AB016061_15127542e-32Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.772012197 (11)gb:AB016061_15127542e-86Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF027E05Sequence553000019 (14)gb:AB016061_15127546e-32Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.696012197 (11)gb:AB016061_15127541e-81Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF029A20Sequence549000019 (14)gb:AB016061_15127545e-50Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.750012197 (11)gb:AB016061_15127547e-94Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF038E03Sequence392000019 (14)gb:AB016061_15127547e-34Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.685012197 (11)gb:AB016061_15127549e-71Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMSF012A17Sequence199000019 (14)gb:SCO939113_1763430.004Streptomyces coelicolor A3(2) complete genome; segment 10/29.776008293 (3)gb:AB016061_15127544e-82Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMSF021G20Sequence654000019 (14)gb:AB016061_15127541e-66Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.735012197 (11)gb:AB016061_15127549e-72Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMSF023K22Sequence612000019 (14)gb:AB016061_15127543e-60Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.769012197 (11)gb:AB016061_15127549e-83Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMSF030P22Sequence688000019 (14)gb:AB016061_15127544e-69Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030P22+ CTGCATGATGCCTGTCATGGCATCGAAAAACTTTGATGC
JMSF021G20+ GC
                      ____________________________________________________________
consensus CTGCATGATGCCTGTCATGGCATCGAAAAACTTTGATGC
 
. : . : . : . : . : . :
JMSF030P22+ TTTATCTGACATAGGATCTACCAAATCGCGAGAGAGAATTAGGTTCCCCAACGAGTTAAA
JMFF003L09+ ATCTGACATAGGATCTACCAAATCGCGAGAGAGAAATAGGTTCCCCAACAAGTTAAA
JMSF023K22+ ATCGCGAGAGAGAAATAGGTTCCCCANCAAGTTAAA
JMSF021G20+ TTTATCTGACATAGGATCTACCAAATCGCGAGAGAGAAATAGGTTCCCCAACAAGTTAAA
                      ____________________________________________________________
consensus TTTATCTGACATAGGATCTACCAAATCGCGAGAGAGAAATAGGTTCCCCAACAAGTTAAA
 
. : . : . : . : . : . :
JMSF030P22+ TGTTGAGAGGAAAACAAAATGTGCTACATGAACCCCAGTCCCTCTCTGCACAGAACTTGC
JMFF003L09+ TGTTGAGAGGAAAACAAAATGTGCCACATGAACCCCAGTCCCTCTCTGCACAGAACTTGC
JMSF023K22+ TGTTGAGAGGAAAACAAAGTGTGCTACATGAACCCCAGTCCCTCTNTGCATAGAATTCGC
JMSF021G20+ TGTTGAGAGGAAAACAAAATGTGCCACATGAACCCCAGTCCCTCTCTGCACAGAACTTGC
JMFF029A20+ GC
JMFF017C13+ GC
                      ____________________________________________________________
consensus TGTTGAGAGGAAAACAAAATGTGCTACATGAACCCCAGTCCCTCTCTGCACAGAACTTGC
 
. : . : . : . : . : . :
JMFF003N15+ ACAGGCACTGTTTC
JMSF030P22+ TTCTTTTTCTATCCATAACAGCATGTCATCAATGCATTTTCTCCTAACAGGCACTGTTTC
JMFF003L09+ TTCTTTTTCTATCCATAACAGCATGTCATCAATGCATTTTCTCCTAACAGCCACTGTTTC
JMSF023K22+ TTCCTTTTCTATCCATAGGAGCATGTCATCAATGCATTTTCTCCTTACAGGCACTGTTTC
JMSF021G20+ TTCTTTTTCTATCCATAACAGCATGTCATCAATGCATTTTCTCCTAACAGCCACTGTTTC
JMFF029A20+ TTCCTTTTCTATCCATAGGAGCATGTCATCAATGCATTTTCTCCTTACAGGCACTGTTTC
JMFF017C13+ TTCCTTTTCTATCCATAGGAGCATGTCATCAATGCATTTTCTCCTTACAGGCACTGTTTC
                      ____________________________________________________________
consensus TTCTTTTTCTATCCATAGGAGCATGTCATCAATGCATTTTCTCCTTACAGGCACTGTTTC
 
. : . : . : . : . : . :
JMFF003N15+ GTTAATCCTCTTATGCACGAACAATTCTACCGTACATATCCTCCTTAACATGCGCCAGTA
JMSF030P22+ GTTAATCCTCTTATGCACGAACAATTCTACCGTACATATCCTCCTTAACATGCGCCAGTA
JMFF003L09+ ATTTATCCTCTTATGCACGAACAATTCCACTGTGCATATCCTCCTTAACATGCGCCAGTA
JMSF023K22+ ATTAATCCTCTTATGCACGAACAATTCCACCGTGCATATCCTCCTTAACACGCGCCAGTA
JMSF021G20+ ATTTATCCTCTTATGCACGAACAATTCCACTGTGCATATCCTCCTTAACATGCGCCAGTA
JMFF029A20+ ATTAATCCTCTTATGCACGAACAATTCCACCGTGCATATCCTCCTTAACACGCGCCAGTA
JMFF038E03+ CGAACAATTCCACCGTGCATATCCTCCTTAACACGCGCCAGTA
JMFF017C13+ ATTAATCCTCTTATGCACGAACAATTCCACCGTGCATATCCTCCTTAACACGCGCCAGTA
JMFF027E05+ ACACGCGCCAGTA
JMFF025P22+ TAACACGCGCCAGTA
JMFF024F23+ ACGCGCCAGTA
                      ____________________________________________________________
consensus ATTAATCCTCTTATGCACGAACAATTCCACCGTGCATATCCTCCTTAACACGCGCCAGTA
 
. : . : . : . : . : . :
JMFF003N15+ GGATCCATACGGGGCTAACGCCAAGGCTCCCTTGTGGTAGCCCTGCACCTTCATGGCGTC
JMSF030P22+ GGATCCATACGGGGCTAACGCCAAGGCTCCCTTGTGGTAGCCCTGCACCTTCATGGCGTC
JMFF003L09+ GGATCCATACGGGGCCAACACCAAGGATCCCTTGTGGTAGCCCTGCACCTTCATGGCGTC
JMSF023K22+ GGATCCATACGGGGCAAACACCAAGGATCCCATATAGTAGCCCTGCACCTTCATGGCGTC
JMSF021G20+ GGATCCATACGGGGCCAACACCAAGGATCCCTTGTGGTAGCCCTGCACCTTCATGGCGTC
JMFF029A20+ GGATCCATACGGGGCAAACGCCAAGGATCCCATATAGTAGCCCTGCACCTTCATGACGTC
JMFF038E03+ GGATCCATNCGGGGCAAACGCCAAGGATCCCATATAGTAGCCCTGCACCTTCATGACGTC
JMFF017C13+ GGATCCATACGGGGCAAACGCCAAGGATCCCATATAGTAGCCCTGCACCTTCATGACGTC
JMFF027E05+ GGATCCATACGGGGCAAACGCCAAGGATCCCATATAGTAGCCCTGCACCTTCATGACGTC
JMFF025P22+ GGATCCATACGGGGCAAACGCCAAGGATCCCATATAGTAGCCCTGCACCTTCATGACGTC
JMFF024F23+ GGATCCATACGGGGCAAACGCCAAGGATCCCATATAGTAGCCCTGCACCTTCATGACGTC
JMFF001H02+ GACGTN
                      ____________________________________________________________
consensus GGATCCATACGGGGCAAACGCCAAGGATCCCATATAGTAGCCCTGCACCTTCATGACGTC
 
. : . : . : . : . : . :
JMFF003N15+ TATCACTTTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMSF030P22+ TATCACTTTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMFF003L09+ TAACACTTTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMSF023K22+ TATCACTTTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMSF021G20+ TAACACTTTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMFF029A20+ TATCACTGTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMFF038E03+ TATCACTGTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMFF017C13+ TATCACTGTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMFF027E05+ TATCACTGTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMFF025P22+ TATCACTGTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMFF024F23+ TATCACTGTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
JMFF001H02+ TATCNCTGTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
                      ____________________________________________________________
consensus TATCACTGTGCGATCTGCAAATGAGACATCATGGTTCTTGAAGAGCTCAGCAGCTGCCTT
 
. : . : . : . : . : . :
JMFF003N15+ GGCAGACAGAATTGCCGTGGTACTGACAGAGCCTATCGTTAACCAAATCACAGAACCATA
JMSF030P22+ GGCAGACAGAATTGCCGTGGTACTGACAGAGCCTATCGTTAACCAAATCACAGAACCATA
JMFF003L09+ GGCAGACAGAATTGCCATGGTACTGACAGAGCCTATCCTTAACCAAATCACAGAACCATA
JMSF023K22+ GGCAGACAGAATTACCATGGTACTCACAGACCCTATCCTTAACCAAATCACAGAACCATA
JMSF021G20+ GGCAGACAGAATTGCCATGGTACTGACAGAGCCTATCCTTAACCAAATCACAGAACCATA
JMFF029A20+ GGCAGACAGAATTGCCATGGTACTGACAGAGCCTATCCTTAACCAAATCACAGAACCATA
JMFF038E03+ GGCAGACAGAATTGCCATGGTACTGACAGAGCCTATCCTTAACCAAATCACAGAACCATA
JMFF017C13+ GGCAGACAGAATTGCCATGGTACTGACAGAGCCTATCCTTAACCAAATCACAGAACCATA
JMFF027E05+ GGCAGACAGAATTGCCATGGTACTGACAGAGCCTATCCTTAACCAAATCACAGAACCATA
JMFF025P22+ GGCAGACAGAATTGCCATGGTACTGACAGAGCCTATCCTTAACCAAATCACAGAACCATA
JMFF024F23+ GGCAGACAGAATTGCCATGGTACTGACAGAGCCTATCCTTAACCAAATCACAGAACCATA
JMFF001H02+ GGCAGACAGAATTGCCATGGTACTGACAGAGCCTATCCTTAACCAAATCACAGAACCATA
                      ____________________________________________________________
consensus GGCAGACAGAATTGCCATGGTACTGACAGAGCCTATCCTTAACCAAATCACAGAACCATA
 
. : . : . : . : . : . :
JMFF003N15+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCATCATGTTCCC
JMSF030P22+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCATCATGTTCCC
JMFF003L09+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCAACATGTTCCC
JMSF023K22+ CTTGTTTTTCATCTCCGNTATTGTNTGATGTGGAATTGCTCCAAGATCCATCATGTTCCC
JMSF021G20+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCAACATGTTCCC
JMFF029A20+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCAACATGTTCCC
JMFF038E03+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCGAAGATCCAACATGTTCCC
JMSF012A17+ TGGAAATGCTCCAAGATCCATCATGTTCCC
JMFF017C13+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCAACATGTTCCC
JMFF027E05+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCAACATGTTCCC
JMFF025P22+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCAACATGTTCCC
JMFF024F23+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCAACATGTTCCC
JMFF001H02+ CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCAACATGTTCCC
                      ____________________________________________________________
consensus CTTGTTTTTCATCTCCGCTATTGTTTGATGTGGAAATGCTCCAAGATCCAACATGTTCCC
 
. : . : . : . : . : . :
JMFF003N15+ AATAACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACATGATGGCTTCTTCCG
JMSF030P22+ AATAACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACATGATGGCTTCTTCCG
JMFF003L09+ AATAACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACTTGATGACTTCTTCCG
JMSF023K22+ AATAACAGGCAACCCAGGCGGTCCTGGAGGTAGTCNGTAGGAACATGATGGNTTCTTCCG
JMSF021G20+ AATAACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACTTGATGACTTCTTCCG
JMFF029A20+ AATTACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACTTGATGACTTCTTCCG
JMFF038E03+ AATTACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACTTGATGACTTCTTCCG
JMSF012A17+ AATAACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACATGATGGCTTCTTCCG
JMFF017C13+ AATTACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACTTGATGACTTCTTCCG
JMFF027E05+ AATTACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACTTGATGACTTCTTCCG
JMFF025P22+ AATTACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACTTGATGACTTCTTCCG
JMFF024F23+ AATTACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACTTGATGACTTCTTCCG
JMFF001H02+ AATTACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACTTGATGACTTCTTCCG
                      ____________________________________________________________
consensus AATTACAGGCAACCCAGGCGGTCCTGGAGGTAGTCTGTAGGAACTTGATGACTTCTTCCG
 
. : . : . : . : . : . :
JMFF003N15+ GGTGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCG
JMSF030P22+ GGTGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCG
JMFF003L09+ GGCGAGTAGAAAGAGCAATCCCGGAATGAGGAAGATGGCAGACCAA
JMSF023K22+ GGNGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCA
JMSF021G20+ GGCGAGTAGAAAGAGCAATCCCGGAATGAGGAAGATGGCAGACCAAACCAAGTACTTCCA
JMFF029A20+ GGCGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCA
JMFF038E03+ GGCGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACC
JMSF012A17+ GGTGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCG
JMFF017C13+ GGCGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCA
JMFF027E05+ GGCGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCA
JMFF025P22+ GGCGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCA
JMFF024F23+ GGCGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCA
JMFF004B01+ CCAAGTACTTCCA
JMFF001H02+ GGCGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCA
                      ____________________________________________________________
consensus GGCGAGTAGAAAGACCAATCCCGGAATCAGGAAGATGGCAGACCAAACCAAGTACTTCCA
 
. : . : . : . : . : . :
JMFF003N15+ TTCCCACTCCATCTCTTTAAAGTTTT
JMSF030P22+ TTCCCACTCCATCTCTTTAAAG-------TTTTGAGGTTTTGCAATTTGCAGGTCC
JMSF023K22+ TTCCCACTCCATCTCTTAAAAG-------TTTTGAGGTTTTGC
JMSF021G20+ TTCCCACTCCATCTCTTAAATG-------TTTTGAGGTTTTGCAATTTGCAGGTCC
JMFF029A20+ TTCCCACTCCATCTCTTAAAAGTTTTTACTTTTGAGGTTTTGCAATTTCCAGG
JMSF012A17+ TTCCCACTCCATCTCTTTAAAG-------TTTTGAGGTTTTGCAATTTGCAGGTCC
JMFF017C13+ TTCCCACTCCATCTCTTAAAAGTTTTTACTTTTGAGGTTTTGCAATTTCCAGG
JMFF027E05+ TTCCCACTCCATCTCTTAAAAGTTTTTACTTTTGAGGTTTTGCAATTTCCAGGTCACTCA
JMFF025P22+ TTCCCACTCCATCTCTTAAAAGTTTTTACTTTTGAGGTTTTGCAATTTCCAGGTCACTCA
JMFF024F23+ TTCCCACTCCATCTCTTAAAAGTTTTTACTTTTGAGGTTTTGCAATTTCCAGGTCACTCA
JMFF004B01+ TTCCCACTCCATCTCNTAAAAGTTTTTACTTTTGAGGTTTTGCAATTTCCAGGTCACTCA
JMFF001H02+ TTCCCACTCCATCTCTTAAAAGTTTTTACTTTTGAGGTTTTGCAATTTCCAGGTCACTCA
                      ____________________________________________________________
consensus TTCCCACTCCATCTCTTAAAAGTTTTTACTTTTGAGGTTTTGCAATTTCCAGGTCACTCA
 
. : . : . : . : . : . :
JMFF027E05+ AATTCTTGTTAATCTGTGTTTATTTAAAGTAGTGTAGCTACCCTGGTCCCCGGGAACTGA
JMFF025P22+ AATTCTTGTTAATCTGTGTTTATTTAAAGTAGTGTAGCTACCCTGGTCCCCGGGAACTGA
JMFF024F23+ AATTCTTGTTAATCTGTGTTTATTTAAAGTAGTGTAGCTACCCTGGTCCCCGGGAACTGA
JMFF004B01+ AATTGTTGTTAATCTGTGTTTATTTAAAGTAGTGTAGCTACCCTGGTCCCCGGGAACTGA
JMFF001H02+ AATTCTTGTTAATCTGTGTTTATTTAAAGTAGTGTAGCTACCCTGGTCCCCGGGAACTGA
                      ____________________________________________________________
consensus AATTCTTGTTAATCTGTGTTTATTTAAAGTAGTGTAGCTACCCTGGTCCCCGGGAACTGA
 
. : . : . : . : . : . :
JMFF027E05+ CCATTCTTATTTCACTTTTAACAGACATCTTGATACAATTGTTGTGAGCAGACTGGGGCC
JMFF025P22+ CCATTCTTATTTCACTTTTAACAGACATCTNGATACAATTGTTGTGAGCAGACTGGGGCC
JMFF024F23+ CCATTCTTATTTCACTTTTAACAGACATCTTGATACAATTGTTGTGAGCAGACTGGGGCC
JMFF004B01+ CCATTCTTATTTCACTTTTAACAGACATCTTGATACAATTGTTGTGAGCAGACTGGGGCC
JMFF001H02+ CCATTCTTATTTCACTTTTAACAGACATCTTGATACAATTGTTGTGAGCAGACTGGGGCC
                      ____________________________________________________________
consensus CCATTCTTATTTCACTTTTAACAGACATCTTGATACAATTGTTGTGAGCAGACTGGGGCC