Previous Contig 000018:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001G09Sequence502000018 (5)gb:AY088411_15734301e-06Arabidopsis thaliana clone 6519 mRNA, complete sequence.650000018 (5)gb:AB007651_15102716e-05Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD9.>gb:AY059107_15644
JMFF016F19Sequence493000018 (5)gb:AY088411_15734306e-08Arabidopsis thaliana clone 6519 mRNA, complete sequence.665000018 (5)gb:AB007651_15102713e-06Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD9.>gb:AY059107_15644
JMFN030D22Sequence472000018 (5)gb:AY088411_15734308e-07Arabidopsis thaliana clone 6519 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016F19- TATTATTTATT
                      ____________________________________________________________
consensus TATTATTTATT
 
. : . : . : . : . : . :
rJMFF001G09- TACAACACCTAGAATTCATTACAACAAAACTAATTTAGATTTGATAAAAT
rJMFF016F19- TAATTTTACATACAACACCTAGAATTCATTACAACAAAACTAATTTAGATTTGATAAAAT
                      ____________________________________________________________
consensus TAATTTTACATACAACACCTAGAATTCATTACAACAAAACTAATTTAGATTTGATAAAAT
 
. : . : . : . : . : . :
rJMFF001G09- TGTATTTGCAAAGTTCAACTCTTACTCAAAAGAAAATCTAAGCACTATAAAAACTATTTA
rJMFF016F19- TGTATTTGCAAAGTTCAACTCTTACTCAAAAGAAAATCTAAGCACTATAAAAACTATTTA
                      ____________________________________________________________
consensus TGTATTTGCAAAGTTCAACTCTTACTCAAAAGAAAATCTAAGCACTATAAAAACTATTTA
 
. : . : . : . : . : . :
rJMFF001G09- ACATGATATGACGCAGTAAGACTTATTTAATTATTACATTGTCAAAATTATACACCCAAT
rJMFF016F19- ACATGATATGACGCAGTAAGACTTATTTAATTATTACATTGTCAAAATTATACACCCAAT
                      ____________________________________________________________
consensus ACATGATATGACGCAGTAAGACTTATTTAATTATTACATTGTCAAAATTATACACCCAAT
 
. : . : . : . : . : . :
rJMFF001G09- TAACACATGACAAAGTCTTGGAAAACGTTGTTAATTAGTTATTAGGGTATGCCGATGATG
rJMFF016F19- TAACACATGACAAAGTCTTGGAAAACGTTGTTAATTAGTTATTAGGGTATGCCGATGATG
                      ____________________________________________________________
consensus TAACACATGACAAAGTCTTGGAAAACGTTGTTAATTAGTTATTAGGGTATGCCGATGATG
 
. : . : . : . : . : . :
rJMFF001G09- GGGATGAAGGGCAAGTAGTAATAGCTGGTTGGTGGAAGTCCCCACTCCCTTGGCAGAGGC
rJMFF016F19- GGGATGAAGGGCAAGTAGTAATAGCTGGTTGGTGGAAGTCCCCACTCCCTTGGCAGAGGC
                      ____________________________________________________________
consensus GGGATGAAGGGCAAGTAGTAATAGCTGGTTGGTGGAAGTCCCCACTCCCTTGGCAGAGGC
 
. : . : . : . : . : . :
rJMFF001G09- AGATCCACTGTCTTTGACCCACCAATACTACCACCCCCACCCCCACCCACACATTTTGCA
rJMFF016F19- AGATCCACTGTCTTTGACCCACCAATACTACCACCCCCACCCCCACCCACACATTTTGCA
JMFF016F19+ CACACATTTTGCA
JMFN030D22+ CCCCCACCCACACATTTTGCA
JMFF001G09+ CCCCCACCCACACATTTTGCA
                      ____________________________________________________________
consensus AGATCCACTGTCTTTGACCCACCAATACTACCACCCCCACCCCCACCCACACATTTTGCA
 
. : . : . : . : . : . :
rJMFF001G09- TTTGGATACTTTGTGTAAAACCTAAGAGGCTCCGAGGTGGTCATGATGTAGTGGCGGCTG
rJMFF016F19- TTTGGACACTTTGTGTAAAACCTAAGAGGCTCCGAGGTGGTCATGATGTAGTGGCGGCTG
JMFF016F19+ TTTGGACACTTTGTGTAAAACCTAAGAGGCTCCGAGGTGGTCATGATGTAGTGGCGGCTG
JMFN030D22+ TTTGGACACTTTGTGTAAAACCTAAGAGGCTCCGAGGTGGTCATGATGTAGTGGCGGCTG
JMFF001G09+ TTTGGATACTTTGTGTAAAACCTAAGAGGCTCCGAGGTGGTCATGATGTAGTGGCGGCTG
                      ____________________________________________________________
consensus TTTGGACACTTTGTGTAAAACCTAAGAGGCTCCGAGGTGGTCATGATGTAGTGGCGGCTG
 
. : . : . : . : . : . :
rJMFF001G09- TGGTCGGATTCTCCGGCGGTAGCTCTGACGACAACCTTGGATTCACATGCTTTCATAGGA
rJMFF016F19- TGGTCGGATTCTCCGGCGGCAGCTCTGACGACAACCTTGGATTCACATGCTTTCATAGGA
JMFF016F19+ TGGTCGGATTCTCCGGCGGCAGCTCTGACGACAACCTTGGATTCACATGCTTTCATAGGA
JMFN030D22+ TGGTCGGATTCTCCGGCGGCAGCTCTGACGACAACCTTGGATTCACATGCTTTGATAGGA
JMFF001G09+ TGGTCGGATTCTCCGGCGGTAGCTCTGACGACAACCTTGGATTCACATGCTTTCATAGGA
                      ____________________________________________________________
consensus TGGTCGGATTCTCCGGCGGCAGCTCTGACGACAACCTTGGATTCACATGCTTTCATAGGA
 
. : . : . : . : . : . :
rJMFF001G09- ATGTAGAGCTGTCGGGTGGCTCCGAGGATCTTGGCGCTGCAGCTGACGACAGAGGATGGG
rJMFF016F19- ATGTAGAGCTGTCGGGTGGCTCCGAGGATCTTGGCGCTGCAGCTGACGACAGAGGATGGG
JMFF016F19+ ATGTAGAGCTGTCGGGTGGCTCCGAGGATCTTGGCGCTGCAGCTGACGACAGAGGATGGG
JMFN030D22+ ATGTAGAGCTGTCGGGTGGCTCCGAGGATCTTGGCGCTGCAGCTGACGACAGAGGATGGG
JMFF001G09+ ATGTAGAGCTGTCGGGTGGCTCCGAGGATCTTGGCGCTGCAGCTGACGACAGAGGATGGG
                      ____________________________________________________________
consensus ATGTAGAGCTGTCGGGTGGCTCCGAGGATCTTGGCGCTGCAGCTGACGACAGAGGATGGG
 
. : . : . : . : . : . :
rJMFF001G09- GATTTTGAAGAAGGGAGAACCACAGTTGTTTCGAAACTCCCATCTTCTTCTGTTGTCGCC
rJMFF016F19- GATTTTGAAGAAGGGAGAACCACAGTTGTTTCGAAACTCCCATCTTCTTCTGTTGTCGCC
JMFF016F19+ GATTTTGAAGAAGGGAGAACCACAGTTGTTTCGAAACTCCCATCTTCTTCTGTTGTCGCC
JMFN030D22+ GATTTTGAAGAAGGGAGAACCACAGTTGTTTCGAAACTCCCATCTTCTTCTGTTGTCGCC
JMFF001G09+ GATTTTGAAGAAGGGAGAACCACAGTTGTTTCGAAACTCCCATCTTCTTCTGTTGTCGCC
                      ____________________________________________________________
consensus GATTTTGAAGAAGGGAGAACCACAGTTGTTTCGAAACTCCCATCTTCTTCTGTTGTCGCC
 
. : . : . : . : . : . :
rJMFF001G09- ATGGCCATGTTTTTCTCCCCACCACACTTCACTGACACTTTCACACCTGA
rJMFF016F19- ATGGCCATGTTTTTCTCCCCACCACACTTCACTGACACTTTCACACCTGAGAGA
JMFF016F19+ ATGGCCATGTTTTTCTCCCCACCACACTTCACTGACACTTTCACACCTGAGAGATGTGGA
JMFN030D22+ ATGGCCATGTTTTTCTCCCAACCACACTTCACTGACACTTTCACACCTGAGAGATGTGGA
JMFF001G09+ ATGGCCATGTTTTTCTCCCCACCACACTTCACTGACACTTTCACACCTGAGAGATGTGGA
                      ____________________________________________________________
consensus ATGGCCATGTTTTTCTCCCCACCACACTTCACTGACACTTTCACACCTGAGAGATGTGGA
 
. : . : . : . : . : . :
JMFF016F19+ GGATGGTTATGGGTATGGGTGCAGTCCAGGCAGGTGACAGAGCCCTTGAAGACATGGGAG
JMFN030D22+ GGATGGTTATGGGTATGGGTGCAGTCCAGGCAGGTGACAGAGCCCTTGAAGACATGGGAG
JMFF001G09+ GGATGGTTATGGGTATGGGTGCAGTCCAGGCAGGTGACAGAGCCCTTGAAGACATGGGAG
                      ____________________________________________________________
consensus GGATGGTTATGGGTATGGGTGCAGTCCAGGCAGGTGACAGAGCCCTTGAAGACATGGGAG
 
. : . : . : . : . : . :
JMFF016F19+ GCGGAGAGGTCGAAGCTGGCGAGAGCTAACGCGACGGAGAGCAAGATTCCGGCGAGCTGA
JMFN030D22+ GCGGAGAGGTCGAAGCTGGCGAGAGCTAACGCGACGGAGAGCAAGATTCCGGCGAGCTGA
JMFF001G09+ GCGGAGAGGTCGAAGCTGGCGAGAGCTAACGCGACGGAGAGCAAGATTCCGGCGAGCTGA
                      ____________________________________________________________
consensus GCGGAGAGGTCGAAGCTGGCGAGAGCTAACGCGACGGAGAGCAAGATTCCGGCGAGCTGA
 
. : . : . : . : . : . :
JMFF016F19+ TGACAGGCGGCAGCCATTATATTGTAGATAATATGACACCACTTAAATGCAAGACAGAAT
JMFN030D22+ TGACAGGCGGCAGCCATTATATTGTAGATA
JMFF001G09+ TGACAGGCGGCAGCCATTATATTGTAGATAATATGACACCACTTAAATGCAAGACAGAAT
                      ____________________________________________________________
consensus TGACAGGCGGCAGCCATTATATTGTAGATAATATGACACCACTTAAATGCAAGACAGAAT