Previous Contig 000017:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F24Sequence410000017 (2)363000017 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF001F24+ GTCCTGTGCGCCATGCTTTACTTTTGAAGAGTGGAGCTGTGCCTCTGGTA
JMFF001F24- GTCCTGTGCGCCATGCTTTACTTTTGAAGAGTGGAGCTGTGCCTCTGGTA
                      ____________________________________________________________
consensus GTCCTGTGCGCCATGCTTTACTTTTGAAGAGTGGAGCTGTGCCTCTGGTA
 
. : . : . : . : . : . :
rJMFF001F24+ TTATGTTTCAAAATTACATGTGAAGATGGTTTGCTCATCGGCCACGGAGATGGTTCCCGT
JMFF001F24- TTATGTTTCAAAATTACATGTGAAGATGGTTTGCTCATCGGCCACGGAGATGGTTCCCGT
                      ____________________________________________________________
consensus TTATGTTTCAAAATTACATGTGAAGATGGTTTGCTCATCGGCCACGGAGATGGTTCCCGT
 
. : . : . : . : . : . :
rJMFF001F24+ TTGATCCCCACGATTGAAACATTTCGATGCCAACAAAAACTGGGCAATGTTGGTCCACCT
JMFF001F24- TTGATCCCCACGATTGAAACATTTCGATGCCAACAAAAACTGGGCAATGTTGGTCCACCT
                      ____________________________________________________________
consensus TTGATCCCCACGATTGAAACATTTCGATGCCAACAAAAACTGGGCAATGTTGGTCCACCT
 
. : . : . : . : . : . :
rJMFF001F24+ CGATATCAGATGCTTTAGATATACAAAGTGTGACAACGCACAAAATCGAGCACGCACCTT
JMFF001F24- CGATATCAGATGCTTTAGATATACAAAGTGTGACAACGCACAAAATCGAGCACGCACCTT
                      ____________________________________________________________
consensus CGATATCAGATGCTTTAGATATACAAAGTGTGACAACGCACAAAATCGAGCACGCACCTT
 
. : . : . : . : . : . :
rJMFF001F24+ CTCAGACTCGATCACAATGAGTTTCCTATAGCGCAAAGAATAATACAAACACAAGTAGGA
JMFF001F24- CTCAGACTCGATCACAATGAGTTTCCTATAGCGCAAAGAATAATACAAACACAAGTAGGA
                      ____________________________________________________________
consensus CTCAGACTCGATCACAATGAGTTTCCTATAGCGCAAAGAATAATACAAACACAAGTAGGA
 
. : . : . : . : . : . :
rJMFF001F24+ ACACTTTGGGTGCCATTGTTACTTATCTAAAAAACTATTTTTTTTTCTAAGTATGTTCTG
JMFF001F24- ACACTTTGGGTGCCATTGTTACTTATCTAAAAAACTATTTTTTTTTCTAAGTATGTTCTG
                      ____________________________________________________________
consensus ACACTTTGGGTGCCATTGTTACTTATCTAAAAAACTATTTTTTTTTCTAAGTATGTTCTG
 
. : . : . : . : . : . :
rJMFF001F24+ CTTAATTTCGGAT
JMFF001F24- CTTAATTTCGGATGTATTTGGTTTAATATTATGAAAATTATGTTTTATGTAAAAAAAAAA
                      ____________________________________________________________
consensus CTTAATTTCGGATGTATTTGGTTTAATATTATGAAAATTATGTTTTATGTAAAAAAAAAA