Previous Contig 000016:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F22Sequence307000016 (73)sp|P77214|CUSF_ECOLI3e-28Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF002C09Sequence245000016 (73)sp|P77214|CUSF_ECOLI3e-14Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF005E18Sequence258000016 (73)sp|P77214|CUSF_ECOLI6e-17Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF005M24Sequence130000016 (73)529011068 (6)pir|G96584|G965845e-60hypothetical protein F20D21.14 [imported] - Arabidopsis thaliana>gb:AE005173_893
JMFF009B05Sequence343000016 (73)sp|P77214|CUSF_ECOLI2e-32Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF015M17Sequence257000016 (73)sp|P77214|CUSF_ECOLI2e-17Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF017A15Sequence251000016 (73)sp|P77214|CUSF_ECOLI3e-15Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF017K17Sequence248000016 (73)sp|P77214|CUSF_ECOLI1e-14Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF019K19Sequence244000016 (73)sp|P77214|CUSF_ECOLI2e-15Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF020A14Sequence250000016 (73)sp|P77214|CUSF_ECOLI2e-17Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF022D23Sequence309000016 (73)sp|P77214|CUSF_ECOLI6e-28Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF022F14Sequence174000016 (73)
JMFF022M16Sequence256000016 (73)sp|P77214|CUSF_ECOLI8e-17Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF022O06Sequence257000016 (73)sp|P77214|CUSF_ECOLI8e-17Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF023M13Sequence257000016 (73)sp|P77214|CUSF_ECOLI2e-17Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF024M20Sequence257000016 (73)sp|P77214|CUSF_ECOLI2e-17Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF024N08Sequence272000016 (73)sp|P77214|CUSF_ECOLI3e-20Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es423021225gb:AY198331_15889713e-21Lolium perenne MADS6 mRNA, complete cds.
JMFF026A11Sequence311000016 (73)sp|P77214|CUSF_ECOLI9e-23Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF026L17Sequence331000016 (73)sp|P77214|CUSF_ECOLI3e-29Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF027C24Sequence257000016 (73)sp|P77214|CUSF_ECOLI2e-17Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF027I23Sequence220000016 (73)sp|P77214|CUSF_ECOLI4e-08Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF029N22Sequence305000016 (73)sp|P77214|CUSF_ECOLI3e-25Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF030I14Sequence250000016 (73)sp|P77214|CUSF_ECOLI1e-13Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF032O11Sequence192000016 (73)sp|P77214|CUSF_ECOLI5e-05Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es205009742 (11)
JMFF034G05Sequence257000016 (73)sp|P77214|CUSF_ECOLI1e-16Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMFF041D05Sequence656000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es622010737 (18)sp|P31600|NFRA_ECOLIe-113Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF041D11Sequence657000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es652010737 (18)sp|P31600|NFRA_ECOLIe-118Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF041D12Sequence652000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es623010737 (18)sp|P31600|NFRA_ECOLIe-113Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF041F22Sequence657000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es637010737 (18)sp|P31600|NFRA_ECOLIe-116Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF041H13Sequence657000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es672010737 (18)sp|P31600|NFRA_ECOLIe-115Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF041J01Sequence657000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es648010737 (18)sp|P31600|NFRA_ECOLIe-118Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF043C03Sequence626000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es641010737 (18)sp|P31600|NFRA_ECOLIe-114Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF043L17Sequence623000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es632010737 (18)sp|P31600|NFRA_ECOLIe-115Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF045H04Sequence610000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es632010737 (18)sp|P31600|NFRA_ECOLIe-115Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF046D16Sequence473000016 (73)sp|P77214|CUSF_ECOLI4e-48Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es468010737 (18)sp|P31600|NFRA_ECOLI3e-82Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF047H10Sequence607000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es584010737 (18)sp|P31600|NFRA_ECOLIe-105Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF047H21Sequence601000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es632010737 (18)sp|P31600|NFRA_ECOLIe-114Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF047J05Sequence607000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es603010737 (18)sp|P31600|NFRA_ECOLIe-109Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF048L21Sequence476000016 (73)sp|P77214|CUSF_ECOLI1e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es414010737 (18)sp|P31600|NFRA_ECOLI4e-71Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF049D24Sequence643000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es646010737 (18)sp|P31600|NFRA_ECOLIe-118Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF049L16Sequence645000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es620010737 (18)sp|P31600|NFRA_ECOLIe-113Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF049P12Sequence590000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es602010737 (18)sp|P31600|NFRA_ECOLIe-110Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF050L20Sequence615000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es608010737 (18)sp|P31600|NFRA_ECOLIe-106Bacteriophage N4 adsorption protein A precursor.>pir|B49351|B49351 bacteriophage
JMFF051E19Sequence621000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF001A04Sequence266000016 (73)sp|P77214|CUSF_ECOLI3e-19Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF002G09Sequence467000016 (73)sp|P77214|CUSF_ECOLI1e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF003O12Sequence253000016 (73)sp|P77214|CUSF_ECOLI5e-16Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF004E10Sequence390000016 (73)sp|P77214|CUSF_ECOLI2e-42Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es473000166 (24)
JMSF005F18Sequence440000016 (73)sp|P77214|CUSF_ECOLI5e-54Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es392008743 (5)
JMSF005J02Sequence365000016 (73)sp|P77214|CUSF_ECOLI1e-36Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es370010756 (9)gb:AY735523_16255651e-24Arabidopsis thaliana hypothetical protein AT1G24480 mRNA, complete cds.
JMSF006L03Sequence271000016 (73)sp|P77214|CUSF_ECOLI1e-27Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es458013803 (5)gb:AP001081_18207801e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0693B08
JMSF007A16Sequence270000016 (73)sp|P77214|CUSF_ECOLI3e-19Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es104022195
JMSF007G05Sequence138000016 (73)215022216gb:AC023838_15392432e-18Arabidopsis thaliana chromosome III P1 MJM20 genomic sequence, complete sequence
JMSF007O11Sequence239000016 (73)sp|P77214|CUSF_ECOLI1e-13Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF009H16Sequence253000016 (73)sp|P77214|CUSF_ECOLI2e-15Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es609011446 (2)gb:AX393034_14668793e-47Sequence 5 from Patent WO0212273.
JMSF010A08Sequence257000016 (73)sp|P77214|CUSF_ECOLI2e-17Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF013L17Sequence179000016 (73)sp|P77214|CUSF_ECOLI2e-04Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF018M24Sequence199000016 (73)sp|P77214|CUSF_ECOLI4e-13Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF021J11Sequence375000016 (73)sp|P77214|CUSF_ECOLI5e-42Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF023B12Sequence399000016 (73)sp|P77214|CUSF_ECOLI2e-45Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF024G09Sequence531000016 (73)sp|P77214|CUSF_ECOLI2e-55Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF024O18Sequence342000016 (73)sp|P77214|CUSF_ECOLI7e-42Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF026D05Sequence162000016 (73)sp|P77214|CUSF_ECOLI1e-19Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF027N12Sequence251000016 (73)sp|P77214|CUSF_ECOLI3e-20Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF028H21Sequence649000016 (73)sp|P77214|CUSF_ECOLI9e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF028O16Sequence632000016 (73)sp|P77214|CUSF_ECOLI2e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF029F13Sequence278000016 (73)sp|P77214|CUSF_ECOLI1e-32Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es601007011 (5)gb:AY039903_15604172e-23Arabidopsis thaliana AT3g18280/MIE15_7 mRNA, complete cds.>gb:AY077680_1567882 A
JMSF036I11Sequence638000016 (73)sp|P77214|CUSF_ECOLI9e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF039F24Sequence419000016 (73)sp|P77214|CUSF_ECOLI8e-48Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es437008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF039P19Sequence493000016 (73)sp|P77214|CUSF_ECOLI6e-53Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF041B20Sequence786000016 (73)sp|P77214|CUSF_ECOLI3e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es
JMSF044M12Sequence176000016 (73)sp|P77214|CUSF_ECOLI5e-18Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es213013362 (5)gb:AY113890_15783014e-09Arabidopsis thaliana unknown protein (At1g05940) mRNA, complete cds.>gb:AF360321
JMSF051B23Sequence686000016 (73)sp|P77214|CUSF_ECOLI3e-56Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041B20+ CGCTGC
                      ____________________________________________________________
consensus CGCTGC
 
. : . : . : . : . : . :
JMSF041B20+ AAATTACTTTGCAACGGGCGCGGGCATTATATCAGCACGGNGCAGTAAGTTATCTGGAAG
                      ____________________________________________________________
consensus AAATTACTTTGCAACGGGCGCGGGCATTATATCAGCACGGNGCAGTAAGTTATCTGGAAG
 
. : . : . : . : . : . :
JMSF051B23+ ACAAACTTTACNTGATCTGAATTATG
JMFF041D05+ TATG
JMFF041J01+ TTATG
JMFF041F22+ TTATG
JMFF041H13+ TTATG
JMFF041D11+ TTATG
JMSF041B20+ TGCTGGATGCCGAGCGTTCTTTATTTGCAACCCGACAAACTTTACTTGATCTGAATTATG
                      ____________________________________________________________
consensus TGCTGGATGCCGAGCGTTCTTTATTTGCAACCCGACAAACTTTACTTGATCTGAATTATG
 
. : . : . : . : . : . :
JMSF051B23+ CCCGTCAGGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF041D12+ CCCGTCAGGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF049L16+ GGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF049D24+ TTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF043C03+ TATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF043L17+ ACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF051E19+ CGCACTTGGTGGCGGTTGACAGCAATATA
JMFF050L20+ TGGTGGCGGTTGACAGCAATATA
JMFF045H04+ GCGGTTGACAGCAATATA
JMFF047J05+ GTTGACAGCAATATA
JMFF047H21+ AGCAATATA
JMFF041D05+ CCCGTCAGGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF041J01+ CCCGTCAGGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF041F22+ CCCGTCAGGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF041H13+ CCCGTCAGGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF041D11+ CCCGTCAGGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMFF047H10+ GTTGACAGCAATATA
JMSF041B20+ CCCGTCAGGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
JMSF028O16+ TACCGCACTTGGTGGCGGTTGACAGCAATATA
JMSF036I11+ TTTGTATACCGCACTTGGNGGCGGTTGACAGCAATATA
JMSF028H21+ AACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
                      ____________________________________________________________
consensus CCCGTCAGGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATA
 
. : . : . : . : . : . :
JMSF051B23+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF041D12+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF049L16+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF049D24+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF043C03+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF043L17+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF051E19+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF050L20+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF045H04+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF047J05+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF047H21+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF049P12+ CGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF041D05+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF041J01+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF041F22+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF041H13+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF041D11+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMFF047H10+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMSF041B20+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMSF028O16+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMSF036I11+ CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
JMSF028H21+ CTNGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
                      ____________________________________________________________
consensus CTCGTCATACTTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTT
 
. : . : . : . : . : . :
JMSF051B23+ ATGTAAGCTCNTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF041D12+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF049L16+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF049D24+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF043C03+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF043L17+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF051E19+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF050L20+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATNTAGAGT
JMFF045H04+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF047J05+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF047H21+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF049P12+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF048L21+ AATTATTTAGAGT
JMFF046D16+ GAGT
JMFF041D05+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF041J01+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF041F22+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF041H13+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF041D11+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMFF047H10+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMSF041B20+ ATGTAAGCTCNTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMSF024G09+ TGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGANTTATTTAGAGT
JMSF028O16+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMSF036I11+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
JMSF039P19+ TTATTTAGAGT
JMSF028H21+ ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
                      ____________________________________________________________
consensus ATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGT
 
. : . : . : . : . : . :
JMSF051B23+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF041D12+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF049L16+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF049D24+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF043C03+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF043L17+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF051E19+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF050L20+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF045H04+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF047J05+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF047H21+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF049P12+ ATGACTTTTAACTCCAGGGGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF048L21+ ATGACTNTAACTNNCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF046D16+ ATGAC-TTTANCTCCAGGAGAGAATAAATGAAAAAAGCNCTGCAAGTCGCAATGTTCAGT
JMFF041D05+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF041J01+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF041F22+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF041H13+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF041D11+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMFF047H10+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMSF041B20+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMSF024G09+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMSF028O16+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMSF036I11+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMSF039P19+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMSF028H21+ ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
JMSF005F18+ TGCAAGTCGCAATGTTCAGT
JMSF002G09+ CCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
                      ____________________________________________________________
consensus ATGACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGT
 
. : . : . : . : . : . :
JMSF051B23+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF041D12+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF049L16+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF049D24+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF043C03+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF043L17+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF051E19+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF050L20+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF045H04+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF047J05+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF047H21+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF049P12+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF048L21+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF046D16+ CTG-TTACCGTTATTGGCT-TAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMSF023B12+ GTTTNCCGTTATTGGCTNTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMSF021J11+ CAGGCTAACGAACATCATCATGAACCCATGAGC
JMSF024O18+ CGAACATCATCATGAAACCATGAGC
JMFF041D05+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF041J01+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF041F22+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF041H13+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF041D11+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMFF047H10+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMSF041B20+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMSF024G09+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMSF028O16+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMSF036I11+ NTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMSF039P19+ NTGTTTACCGTTATTGGCTNTAATGNCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMSF028H21+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMSF005F18+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
JMSF039F24+ TTACCGTTATTGGCTTTAATGCCCAGGCTAACGNACATCATCATGAANCCATGAGC
JMSF004E10+ GCTAACGAACATCNTCATGAAACCATGAGC
JMSF005J02+ GC
JMSF002G09+ CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
                      ____________________________________________________________
consensus CTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGC
 
. : . : . : . : . : . :
JMSF051B23+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF041D12+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF049L16+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF049D24+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF043C03+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF043L17+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF051E19+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF050L20+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF045H04+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF047J05+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF047H21+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF049P12+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF048L21+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF046D16+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMSF023B12+ GAAGCACAACCACAGGTTATTAGCGCCNCTGGCGTGGTAAAGGGTATCGATNTGGAAAGC
JMSF021J11+ GAAGCACAACCNCAGGTTATNAGCGCCACTGGCGTGNTAAANGGTATCGATCTGGAAAGC
JMSF024O18+ GAAGCACANCCACNGGTTATTAGCGCCACNGGCGTGGTAAAGGGTATCGATNTGGAAAGC
JMFF026L17+ CACAGGTTATTAGCGCCGCTGGCGTGGTAAAGGGTATNGNTNTGGAAAGC
JMSF006L03+ TCTGGAAAGC
JMSF029F13+ AGCGCCACTGGCGTGGTAAAGGGTNTCGATNTNGAAAGC
JMFF041D05+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF041J01+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF041F22+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF041H13+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF041D11+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF047H10+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMSF041B20+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMSF024G09+ GAAGCACAACCACAGGTTATTAGCGCCNCTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMSF028O16+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMSF036I11+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMSF039P19+ GAAGCACANCCNCAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTNTCGATNTGGAAAGC
JMSF028H21+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTNTCGATCTGGAAAGC
JMSF005F18+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMSF039F24+ GAAGCACAACCACAGGTTATTAGCGCCNCTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMSF004E10+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMSF005J02+ GAAGCACANCCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF009B05+ TATTAGCGCCNCTGGCGTGGTAAAGGGTNTCGATCTGGAAAGC
JMFF022D23+ CTGGAAAGC
JMFF026A11+ ATCTGGAAAGC
JMSF002G09+ GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
JMFF029N22+ AAAGC
JMFF001F22+ GGAAAGC
                      ____________________________________________________________
consensus GAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGC
 
. : . : . : . : . : . :
JMSF051B23+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF041D12+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF049L16+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF049D24+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF043C03+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF043L17+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF051E19+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF050L20+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF045H04+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF047J05+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF047H21+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF049P12+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF048L21+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF046D16+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF023B12+ AAAAAAATCACCATCCATCACGATNCGATTGCTGCCGTGAANTGGCCGGAGATGACCATG
JMSF021J11+ AAAAAAATCACCATCCATCNCGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF024O18+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF026L17+ AAAAAAATCNCCATCCATCNCGATCCGATTGNTGCCGTGANNTGGCCGGAGATGACCATG
JMSF006L03+ AAAAAAATCACCATCCATCACGATCCGATNGNTGCCGTGAACTGGCCGGAGATGACCATG
JMSF029F13+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF041D05+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF041J01+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF041F22+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF041H13+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF041D11+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF047H10+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF041B20+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF024G09+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF028O16+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF036I11+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF039P19+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF028H21+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF005F18+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF039F24+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMSF004E10+ AAAAAAATCACCATCCATCACGATCCGATTGCTNCCGTGAACTGGCCGGAGATGACCATG
JMSF005J02+ AAAAAAATCACCATCCATCACGATCCGATTGNTGCCGTGAACTGGCCGGAGATGACCATG
JMFF009B05+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF022D23+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGANCTGGCCGGAGATGACCATG
JMFF026A11+ AAAAAAATCNCCATCCATCACGATCNGATTGCTGCCGTGANCNGNCCGGAGATGACCATG
JMSF002G09+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF029N22+ AAAAAAATCACCATCCATCNCGATCCGATTGCTGCCGTGANCTGGCCGGAGATGACCATG
JMSF007A16+ GCTGCCGTGAACTGNCCGGAGATGACCATG
JMSF001A04+ CCGTGAACTGGCCGGAGATGACCATG
JMFF024N08+ TTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF023M13+ GGCCGGAGATGACCATG
JMSF010A08+ CCGGAGATGACCATG
JMFF024M20+ GGCCGGAGATGACCATG
JMFF034G05+ GGCCGGAGATGACCATG
JMFF022M16+ GCCGGAGATGACCATG
JMFF027C24+ CCGGAGATGACCATG
JMFF020A14+ CCGGAGATGACCATG
JMSF003O12+ GGAGATGACCATG
JMFF015M17+ GGCCGGAGATGACCATG
JMFF022O06+ GGCCGGAGATGACCATG
JMFF005E18+ TGGCCGGAGANGACCATG
JMSF009H16+ GGAGATGACCATG
JMFF002C09+ CCATG
JMSF027N12+ GTGAACTGGCCGGAGATGACCATG
JMFF017A15+ CCGGAGATGACCATG
JMFF030I14+ GATGACCATG
JMFF019K19+ ATGACCATG
JMFF017K17+ ATGACCATG
JMSF044M12+ CCGTGAACTGGCCGGAGATGACCATG
JMSF026D05+ TTGCTGCCGTGAACTGGCCGGAGATGACCATG
JMFF001F22+ AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
                      ____________________________________________________________
consensus AAAAAAATCACCATCCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATG
 
. : . : . : . : . : . :
JMSF051B23+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF041D12+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF049L16+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF049D24+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF043C03+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF043L17+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF051E19+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF050L20+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF045H04+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF047J05+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF047H21+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF049P12+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF048L21+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF046D16+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF023B12+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF021J11+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF024O18+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF026L17+ CGCTTTACCATCACCCCGCAGANGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF006L03+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF029F13+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF041D05+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF041J01+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF041F22+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF041H13+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF041D11+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF047H10+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF041B20+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF024G09+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF028O16+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF036I11+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF039P19+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF028H21+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF005F18+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF039F24+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF004E10+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAANCCGGCGACAAAGTGGCG
JMSF005J02+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAANCCGGCGACAAAGTGGCG
JMFF009B05+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGNGACAAAGTGGCG
JMFF022D23+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF026A11+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF002G09+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF029N22+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF007A16+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF001A04+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAANCCGGCGACAAAGTGGCG
JMFF024N08+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF023M13+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF010A08+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF024M20+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF034G05+ CGCTTTACCATCACCCCGCAGATGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF022M16+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAANCCGGCGACAAAGTGGCG
JMFF027C24+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF020A14+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF003O12+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAANCCGGCGACAAAGTGGCG
JMFF015M17+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF022O06+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAANCCGGCGACAAAGTGGCG
JMFF005E18+ CGCTTTANCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGNG
JMSF009H16+ CGCTTTNCCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF002C09+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF027N12+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF007O11+ GCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF017A15+ CGCTTTACCATCACCCCGCANACGAAAATGAGTGAAATTAAAGCCGNCGACAAAGTGGCG
JMFF030I14+ CGCTTTNCCATCACCCCGCAGACGAAAATGAGTGAAATTAAANCCGGCGACAAAGTGGCG
JMFF019K19+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF017K17+ CGCTTTACCATCACCCCNCAGACGAAAATGAGTGAAATTAAANCCGGCGACAAAGTGGCG
JMFF027I23+ GAAAATGAGTGAAATTAAANCCGGNGACAAAGTGGCG
JMSF018M24+ TTTACCATCACCCCGCAGNCGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMFF032O11+ CCGGCGACAAAGTGGCG
JMSF044M12+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAANCCGGCGGCAAAGTGGCG
JMSF026D05+ CGCTTTNCCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
JMSF013L17+ AACCGGCGACAAANTGGCG
JMFF005M24+ ACAAAGTGGCG
JMFF001F22+ CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
                      ____________________________________________________________
consensus CGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCG
 
. : . : . : . : . : . :
JMSF051B23+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF041D12+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF049L16+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF049D24+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF043C03+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF043L17+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF051E19+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF050L20+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF045H04+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF047J05+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF047H21+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF049P12+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF048L21+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF046D16+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF023B12+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCANCCAGTAA
JMSF021J11+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF024O18+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF026L17+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTNCAGGATATTAAAGTCAGCCAGTAA
JMSF006L03+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTNA
JMSF029F13+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCANCCAGTAA
JMFF041D05+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF041J01+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF041F22+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF041H13+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF041D11+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF047H10+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF041B20+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF024G09+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTNCAGGATATTAAAGTCAGCCAGTAA
JMSF028O16+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF036I11+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF039P19+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF028H21+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF005F18+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF039F24+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF004E10+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTNCAGGATATTAAAGTCAGCCAGTAA
JMSF005J02+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF009B05+ TTTAATTTTGTCCANCAGGGCAACCTTTCTTTATTNCAGGATATTAAAGTCAGCCAGTAA
JMFF022D23+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF026A11+ TTTAATNTTGTCCAGCAGGGCANCCTTTNTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF002G09+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF029N22+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTNCAGGATATTAAAGTCAGCCAGTAA
JMSF007A16+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF001A04+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF024N08+ TTTAATTTTGTCCAGCAGGGCAACCTTTNTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF023M13+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF010A08+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF024M20+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF034G05+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF022M16+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF027C24+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF020A14+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF003O12+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF015M17+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF022O06+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF005E18+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF009H16+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTNCAGGATATTAAAGTCAGCCAGTAA
JMFF002C09+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTNCAGGATATTAAAGTCAGCCAGTAA
JMSF027N12+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMSF007O11+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF017A15+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF030I14+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTNCAGGATATTAAAGTCAGCCNGTAA
JMFF019K19+ TTTAATTTTGTCCANCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF017K17+ TTTAATTTTGTCCAGCAGGGCNACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF027I23+ TTTAATTTTGTCCANCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAN
JMSF018M24+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
JMFF032O11+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTNCAGGATATTAAAGTCAGCCAGTAA
JMSF044M12+ TTTAATTTTGTCCAGCAGGGCAACCTTTNTTTATTGCAGGATATTAAAGTCAGCCAGTAA
JMSF026D05+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCNGTAA
JMFF022F14+ TTTGTCCAGCAGGGCAACCTTTCNTTANTNCAGGATATTAAAGTCAGCCAGTAA
JMSF013L17+ TTTAATTTTGTCCAGCAGGGCAACCTTTCNTTATTACAGGATANTAAAGTCANCCAGTAA
JMSF007G05+ TTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTNCAGGATATTAAAGTCAGCCAGTAA
JMFF005M24+ TTTAATNTTGTCCANCAGGGCATCCTTTNTTTANTACAGGATATTNNAGTCAGCCAGTAA
JMFF001F22+ TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
                      ____________________________________________________________
consensus TTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA
 
. : . : . : . : . : . :
JMSF051B23+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF041D12+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF049L16+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF049D24+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF043C03+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF043L17+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF051E19+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF050L20+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF045H04+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF047J05+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF047H21+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF049P12+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF048L21+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF046D16+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF023B12+ CCCAGGTTTAATGNGATGAAAAAAATCGCGNTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF021J11+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATNATNGNCNGCATGATCGCGGGCGGT
JMSF024O18+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGNCAGCATGATCGCGGGCGGT
JMFF026L17+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF006L03+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF029F13+ CCCAGGTTTAATGAGNNGAAAAAAATCGCGCTTATNATCGGCAGCATGATCGCGGGCGG
JMFF041D05+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF041J01+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF041F22+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF041H13+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF041D11+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF047H10+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF041B20+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF024G09+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF028O16+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF036I11+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF039P19+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF028H21+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF005F18+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF039F24+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF004E10+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGNCAGCATGATCGCGGGCGGT
JMSF005J02+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF009B05+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF022D23+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF026A11+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF002G09+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF029N22+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF007A16+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF001A04+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF024N08+ CCCAGGTTTAATGAGATGAAAAAAATNGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF023M13+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF010A08+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF024M20+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF034G05+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF022M16+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF027C24+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF020A14+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF003O12+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF015M17+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF022O06+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF005E18+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF009H16+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF002C09+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF027N12+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATNATNGGCAGCATGATCGCGGGCGGT
JMSF007O11+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATNGGCAGCATGATCGCGGGCGGT
JMFF017A15+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF030I14+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF019K19+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF017K17+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF027I23+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF018M24+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMFF032O11+ CCCAGGTNTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF044M12+ CCCAGGTTTAATGAGANGNAAAAAATCGCG
JMSF026D05+ CCCAGGTTTA
JMFF022F14+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF013L17+ CCCNGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
JMSF007G05+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATNATTGGCAGCATGATCGCGGGCGGT
JMFF005M24+ CCCAGGTTTAATGAGANGAAAAAAATCGCGCTTATTATCGGCAGCATNATNGCGGGCGG
JMFF001F22+ CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
                      ____________________________________________________________
consensus CCCAGGTTTAATGAGATGAAAAAAATCGCGCTTATTATCGGCAGCATGATCGCGGGCGGT
 
. : . : . : . : . : . :
JMSF051B23+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMFF041D12+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF049L16+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF049D24+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF043C03+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF043L17+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF051E19+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF050L20+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF045H04+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF047J05+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF047H21+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF049P12+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF048L21+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGG
JMFF046D16+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMSF023B12+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGA
JMSF021J11+ ATTATNTCTGCGGCAGGTTTTNCNTGGGTNGCAAAGGCGGAA
JMSF024O18+ ATTATTTCTGCGGCAGG
JMFF026L17+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGA
JMSF006L03+ ATTATTTCTGCGGCAGGTTTT
JMFF041D05+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF041J01+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF041F22+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF041H13+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF041D11+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMFF047H10+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAG
JMSF041B20+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF024G09+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAA
JMSF028O16+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF036I11+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF039P19+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF028H21+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF005F18+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF039F24+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF004E10+ ATTATTTCTGCGGCAGGTTTTACNTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF005J02+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMFF009B05+ ATTATTTCTGCGGCAGGTNTTACCNGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAA
JMFF022D23+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAA
JMFF026A11+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCNTGCAGAAA
JMSF002G09+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMFF029N22+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF007A16+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF001A04+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAA
JMFF024N08+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGA
JMFF023M13+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF010A08+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMFF024M20+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAA
JMFF034G05+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMFF022M16+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMFF027C24+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAA
JMFF020A14+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAA
JMSF003O12+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMFF015M17+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCNCCTGCAGAAA
JMFF022O06+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAA
JMFF005E18+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF009H16+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMFF002C09+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMSF027N12+ ATTATTTCTGCGGCAGGTTTTACNTGGGTTGCAAAGGCGGAAC
JMSF007O11+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
JMFF017A15+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCNTGCAGA
JMFF030I14+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAA
JMFF019K19+ ATTATTTNTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCNTGCAGAA
JMFF017K17+ ATTATTTNTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGANCCGCNTGCAGAA
JMFF027I23+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAA
JMSF018M24+ ATTATTTCTGCGGCAGGTTTTA
JMFF032O11+ ATTATTTCTGCGGCAGGTNTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGA
JMFF022F14+ ATTATTTNTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGANCCGCCTGCAGAAA
JMSF013L17+ ATTATTTNTGCGNCAGGTTTTACCTGGGNNGCAAAGGCGG
JMSF007G05+ ATTATTTCTGCGGCAGGTT
JMFF001F22+ ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG
                      ____________________________________________________________
consensus ATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAAACG