Previous Contig 000015:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F19Sequence451000015 (2)608020647gb:AY494790_16088612e-40Momordica charantia var. abbreviata phytoene desaturase (PDS) mRNA, complete cds
JMFS160G03Sequence295000015 (2)sp|P80093|CRTI_CAPAN3e-04Phytoene dehydrogenase, chloroplast precursor (EC 1.14.99.-) (Phytoene desaturas

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS160G03+ GATAGTCCATGCAAACTACCTTCAAAGGGCGGTACCCCCTCCCTAATTTGGGCA
JMFF001F19+ CAAAGGGCGGTACCCCCTCCCCAATTTGGGCA
                      ____________________________________________________________
consensus GATAGTCCATGCAAACTACCTTCAAAGGGCGGTACCCCCTCCCTAATTTGGGCA
 
. : . : . : . : . : . :
JMFS160G03+ TAACACCATTGCTAGTAGGAATCCTCAATTTAGAGCCCATTGACCAGCTCGCTCCAAATG
JMFF001F19+ TAACACCATTGCTAGTAGGAATCCTCAATTTAGAGCCCATTGAGTAGCTCGCTCCAAATG
                      ____________________________________________________________
consensus TAACACCATTGCTAGTAGGAATCCTCAATTTAGAGCCCATTGAGTAGCTCGCTCCAAATG
 
. : . : . : . : . : . :
JMFS160G03+ ATAGCGCATTTACTTCTGCTGAACCAACACGACAACCAACTCTAGAGGAAGACGCCAAGC
JMFF001F19+ ATAGCGCATTTACTTCTGCTGAACCAACACGACAACCAACTCTAGAGGAAGACGCCAAGC
                      ____________________________________________________________
consensus ATAGCGCATTTACTTCTGCTGAACCAACACGACAACCAACTCTAGAGGAAGACGCCAAGC
 
. : . : . : . : . : . :
JMFS160G03+ TAACAGCAGAAACATGTCCAATGTGGGACATTTTGCCAAATCCTATACTAAAAACGCGAT
JMFF001F19+ TAACAGCAGAAACATGTCCAATGTGGGACATTTTGCCAAATCCTATACTAAAAACGCGAT
                      ____________________________________________________________
consensus TAACAGCAGAAACATGTCCAATGTGGGACATTTTGCCAAATCCTATACTAAAAACGCGAT
 
. : . : . : . : . : . :
JMFS160G03+ CACTTTGGGAAACTATACATTCTTCAAGAGTATCAATTCAACATTGCTCACACACCACTA
JMFF001F19+ CACTTTGGGAAACTATA-ATTCTTCAAGAGTATCAATTCAACATTGCTCACACACCACTA
                      ____________________________________________________________
consensus CACTTTGGGAAACTATACATTCTTCAAGAGTATCAATTCAACATTGCTCACACACCACTA
 
. : . : . : . : . : . :
JMFS160G03+ A
JMFF001F19+ ATCCTTTTTGAGGGAAAGAACAGCAGGAAAATTTCTATAAACTGCAAAATGGGATTTGAA
                      ____________________________________________________________
consensus ATCCTTTTTGAGGGAAAGAACAGCAGGAAAATTTCTATAAACTGCAAAATGGGATTTGAA
 
. : . : . : . : . : . :
JMFF001F19+ TTGAAGCTAATCTTTGTCAAATTTTATAAAGAAGATGATAAATGAAGAAGGAAATGGGTG
                      ____________________________________________________________
consensus TTGAAGCTAATCTTTGTCAAATTTTATAAAGAAGATGATAAATGAAGAAGGAAATGGGTG
 
. : . : . : . : . : . :
JMFF001F19+ CAGAAAAGAGGTTGGAGACTATGGAAGTTTGGCATATAGCTGAAAATGAAAATAGTGAAT
                      ____________________________________________________________
consensus CAGAAAAGAGGTTGGAGACTATGGAAGTTTGGCATATAGCTGAAAATGAAAATAGTGAAT