Previous Contig 000014:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F17Sequence524000014 (2)gb:OSA312313_16925164e-28Oryza sativa putative B'kappa gene for protein phosphatase 2A B'kappa subunit, e784008179 (2)gb:OSA312313_16925161e-65Oryza sativa putative B'kappa gene for protein phosphatase 2A B'kappa subunit, e
JMFF042J23Sequence648000014 (2)gb:AY059748_15646056e-44Arabidopsis thaliana putative AtBgamma protein (At5g25510) mRNA, complete cds.>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042J23+ TCATACACGAGCTGTAAATGGTACCAGGCGGGATCGAAGAACAGTTCT
                      ____________________________________________________________
consensus TCATACACGAGCTGTAAATGGTACCAGGCGGGATCGAAGAACAGTTCT
 
. : . : . : . : . : . :
JMFF042J23+ TCATCCTCGCTCTCGCCCCGAGCATGGGAGGCACACTTTGGTGGGAAATCTCTAAACAGG
                      ____________________________________________________________
consensus TCATCCTCGCTCTCGCCCCGAGCATGGGAGGCACACTTTGGTGGGAAATCTCTAAACAGG
 
. : . : . : . : . : . :
JMFF042J23+ TTAACCGCACACATTCTACAAACTGCAGCAATTGCTGATTCGGTGCATTTCACCGACCCC
JMFF001F17+ TACAAACTGCAGCAATTGCTGATTCGGTGCATTTCACCGACCCC
                      ____________________________________________________________
consensus TTAACCGCACACATTCTACAAACTGCAGCAATTGCTGATTCGGTGCATTTCACCGACCCC
 
. : . : . : . : . : . :
JMFF042J23+ GAGGCAACAAAATCGTTGAGCTCGAGTAATACCTGACGCTTCAGATCTTTCTCAGCTGCG
JMFF001F17+ GAGGCAACAAAATCGTTGAGCTCGAGTAATACCTGACGCTTCAGATCTTTCTCAGCTGCG
                      ____________________________________________________________
consensus GAGGCAACAAAATCGTTGAGCTCGAGTAATACCTGACGCTTCAGATCTTTCTCAGCTGCG
 
. : . : . : . : . : . :
JMFF042J23+ TTCTTGTCTGGATCACCGAAATCATAAACCGAGCAGCAAAGGTTCAGTTTACTCACAAGC
JMFF001F17+ TTCTTGTCTGGATCACCGAAATCATAAACCGAGCAGCAAAGGTTCAGTTTACTCACAAGC
                      ____________________________________________________________
consensus TTCTTGTCTGGATCACCGAAATCATAAACCGAGCAGCAAAGGTTCAGTTTACTCACAAGC
 
. : . : . : . : . : . :
JMFF042J23+ AGGCCTTGTTTCTCGCCATTCGAAACATCCTTAAAGCACAAATGTGGCGAAATGGATTCC
JMFF001F17+ AGGCCTTGTTTCTCGCCATTCGAAACATCCTTAAAGCACAAATGTGGCGAAATGGATTCC
                      ____________________________________________________________
consensus AGGCCTTGTTTCTCGCCATTCGAAACATCCTTAAAGCACAAATGTGGCGAAATGGATTCC
 
. : . : . : . : . : . :
JMFF042J23+ CCTCCCGCCACAATGCTGGCGGGGAAAATTGCTGATGACACGCGTTTCACTACATTTAGC
JMFF001F17+ CCTCCCGCCACAATGCTGGCGGGGAAAATTGCTGATGACACGCGTTTCACTACATTTAGC
                      ____________________________________________________________
consensus CCTCCCGCCACAATGCTGGCGGGGAAAATTGCTGATGACACGCGTTTCACTACATTTAGC
 
. : . : . : . : . : . :
JMFF042J23+ CGGTTCGCTATGACATTGCAGCTGTTAGTGAACTGCATCCCATTGCCCGAGTTCGTAGG
JMFF001F17+ CGGTTCACTATGACATTGCAGCTGTTAGTGAACTGCATCCCATTGCCCGAGTTCGTAGGA
                      ____________________________________________________________
consensus CGGTTCGCTATGACATTGCAGCTGTTAGTGAACTGCATCCCATTGCCCGAGTTCGTAGGA
 
. : . : . : . : . : . :
JMFF001F17+ TCATTGCAAGAATTTGGTTGAGCCCCAGATGAGTCCAGAGAATCAGATTTCAATGATTTT
                      ____________________________________________________________
consensus TCATTGCAAGAATTTGGTTGAGCCCCAGATGAGTCCAGAGAATCAGATTTCAATGATTTT
 
. : . : . : . : . : . :
JMFF001F17+ CTAGGAATTTTCGCAAGAATTTGCTTGAGCATAGTAGCAAAGCTCCAATGAATGTAAAGA
                      ____________________________________________________________
consensus CTAGGAATTTTCGCAAGAATTTGCTTGAGCATAGTAGCAAAGCTCCAATGAATGTAAAGA
 
. : . : . : . : . : . :
JMFF001F17+ TCAAATCTGAATTAAGAGGAAAGTAGAAAAGGGCATATAGCAGATTCCTGGGAGAAAAGC
                      ____________________________________________________________
consensus TCAAATCTGAATTAAGAGGAAAGTAGAAAAGGGCATATAGCAGATTCCTGGGAGAAAAGC