Previous Contig 000013:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F16Sequence610000013 (3)pir|C86445|C864453e-83hypothetical protein F3C3.11 [imported] - Arabidopsis thaliana>gb:AE005172_89204718010665 (8)pir|C86445|C864451e-35hypothetical protein F3C3.11 [imported] - Arabidopsis thaliana>gb:AE005172_89204
JMFF025G20Sequence513000013 (3)pir|C86445|C864452e-72hypothetical protein F3C3.11 [imported] - Arabidopsis thaliana>gb:AE005172_89204240010665 (8)
JMFF034G09Sequence615000013 (3)pir|C86445|C864456e-88hypothetical protein F3C3.11 [imported] - Arabidopsis thaliana>gb:AE005172_89204707010665 (8)pir|C86445|C864458e-25hypothetical protein F3C3.11 [imported] - Arabidopsis thaliana>gb:AE005172_89204

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF034G09+ ACATAAAGTAATAATATTTCGCTGCAGATCTCCTTTCAAGCACTGAAAATGCCAC
JMFF001F16+ TGAAAATGCCAC
                      ____________________________________________________________
consensus ACATAAAGTAATAATATTTCGCTGCAGATCTCCTTTCAAGCACTGAAAATGCCAC
 
. : . : . : . : . : . :
JMFF034G09+ ATGCCCCTCGATCTTCGACATGATCATCAGAATGGTTGGAAGAACATACAGGAAAATCTT
JMFF001F16+ ATGCCCCTCGATCTTCGACATGATCATCAGAATGGTTGGAAGAACATACAGGAAAATCTT
                      ____________________________________________________________
consensus ATGCCCCTCGATCTTCGACATGATCATCAGAATGGTTGGAAGAACATACAGGAAAATCTT
 
. : . : . : . : . : . :
JMFF034G09+ TAGAGCTAAACCCGGAAGGAAACCTTGTAGGAAAGACTTTACGAATTTCCATTCAATTAA
JMFF025G20+ TAGGAAAGACTTTACGAATTTCCATTCAATTAA
JMFF001F16+ T--AGCTAAACCCGGAAGGAAACCTTGTAGGAAAGACTTTACGAATTTCCATTCAATTAA
                      ____________________________________________________________
consensus TAGAGCTAAACCCGGAAGGAAACCTTGTAGGAAAGACTTTACGAATTTCCATTCAATTAA
 
. : . : . : . : . : . :
JMFF034G09+ CGGTCTGAGGAAAGGGGCAACTTTTTCTAGACCTTCCAAATTTGCCAGTGATTGCACGAA
JMFF025G20+ CGGTCTGAGGAAAGGGGCAACTTTTTCTAGACCTTCCAAATTTGCCAGTGATTGCACGAA
JMFF001F16+ CGGTCTGAGGAAAGGGGCAACTTTTTCTAGACCTTCCAAATTTGCCAGTGATTGCACGAA
                      ____________________________________________________________
consensus CGGTCTGAGGAAAGGGGCAACTTTTTCTAGACCTTCCAAATTTGCCAGTGATTGCACGAA
 
. : . : . : . : . : . :
JMFF034G09+ GGCGATAGGTATCAAGTAGAAAAAGACCAAAGCAAAAACCGATATCGCTATCACCAATCT
JMFF025G20+ GGCGATAGGTATCAAGTAGAAAAAGACCAAAGCAAAAACCGATATCGCTATCACCAATCT
JMFF001F16+ GGCGATAGGTATCAAGTAGAAAAAGACCAAAGCAAAAACCGATATCGCTATCACCAATCT
                      ____________________________________________________________
consensus GGCGATAGGTATCAAGTAGAAAAAGACCAAAGCAAAAACCGATATCGCTATCACCAATCT
 
. : . : . : . : . : . :
JMFF034G09+ CCGGATGCTCAGCGAAACGAATGATATCGATAGGTTCTTCCAGAATATATCCCGAGGCTC
JMFF025G20+ CCGGATGCTCAGCGAAACGAATGATATCGATAGGTTCTTCCAGAATATATCCCGAGGCTC
JMFF001F16+ CCGGATGCTCAGCGAAACGAATGATATCGATAGGTTCTTCCAGAATATATCCCGAGGCTC
                      ____________________________________________________________
consensus CCGGATGCTCAGCGAAACGAATGATATCGATAGGTTCTTCCAGAATATATCCCGAGGCTC
 
. : . : . : . : . : . :
JMFF034G09+ AGGAGCCCAATTCGTTAACCACAGCGTGGGGTTCTTACTTTGTTGAGTCTGGGCACAAAC
JMFF025G20+ AGGAGCCCAATTCGTTAACCACAGCGTGGGGTTCTTACTTTGTTGAGTCTGGGCACAAAC
JMFF001F16+ AGGAGCCCAATTCGTTAACCACAGCGTGGGGTTCTTACTTTGTTGAGTCTGGGCACAAAC
                      ____________________________________________________________
consensus AGGAGCCCAATTCGTTAACCACAGCGTGGGGTTCTTACTTTGTTGAGTCTGGGCACAAAC
 
. : . : . : . : . : . :
JMFF034G09+ GGCTGCCCCCCATCTTGAATCGAACGATACAAAGGCAGCTGGAATGATACACTTCGGGTC
JMFF025G20+ GGCTGCCCCCCATCTTGAATCGAACGATACAAAGGCAGCTGGAATGATACACTTCGGGTC
JMFF001F16+ GGCTGCCCCCCATCTTGAATCGAACGATACAAAGGCAGCTGGAATGATACACTTCGGGTC
                      ____________________________________________________________
consensus GGCTGCCCCCCATCTTGAATCGAACGATACAAAGGCAGCTGGAATGATACACTTCGGGTC
 
. : . : . : . : . : . :
JMFF034G09+ CTTAAGAATCTTCTCCCGCTCTATTGTCAACATTCTGTCAAACTCTTTAATCTGGCGTTT
JMFF025G20+ CTTAAGAATCTTCTCCCGCTCTATTGTCAACATTCTGTCAAACTCTTTAATCTGGCGTTT
JMFF001F16+ CTTAAGAATCTTCTCCCGCTCTATTGTCAACATTCTGTCAAACTCTTTAATCTGGCGTTT
                      ____________________________________________________________
consensus CTTAAGAATCTTCTCCCGCTCTATTGTCAACATTCTGTCAAACTCTTTAATCTGGCGTTT
 
. : . : . : . : . : . :
JMFF034G09+ ATAGTACTCAACCGAATCGACTTTCTTGCCCCAAAGTCCAAGGAAGCCTGTCT
JMFF025G20+ ATAGTACTCAACCGAATCGACTTTCTTGCCCCAAAGTCCAAGGAAGCCTGTCTTACTGGT
JMFF001F16+ ATAGTACTCAACCGAATCGACTTTCTTGCCCCAAAGTCCAAGGAAGCCTGTCTTACTGGT
                      ____________________________________________________________
consensus ATAGTACTCAACCGAATCGACTTTCTTGCCCCAAAGTCCAAGGAAGCCTGTCTTACTGGT
 
. : . : . : . : . : . :
JMFF025G20+ CGGCCTCTTGCCCGGATTTCTTTCGAGTTTAAGCTGGTTATAATCCAGCCAATTTTGAAG
JMFF001F16+ CGGCCTCTTGCCCGGATTTCTTTCGAGTTTAAGCTGGTTATAATCCAGCCAATTTTGAAG
                      ____________________________________________________________
consensus CGGCCTCTTGCCCGGATTTCTTTCGAGTTTAAGCTGGTTATAATCCAGCCAATTTTGAAG