Previous Contig 000012:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F01Sequence274000012 (2)gb:AY351702_16016925e-14Ipomoea trifida glycosyltransferase 10 mRNA, complete cds.140008176 (2)
JMFF023M15Sequence535000012 (2)gb:AY351702_16016923e-66Ipomoea trifida glycosyltransferase 10 mRNA, complete cds.446008176 (2)gb:AY351700_16016904e-16Ipomoea trifida glycosyltransferase 1 mRNA, complete cds.>gb:AY448010S1_1606573

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF023M15+ ACGGTCGGATGGCCAGGCAAAGTTACAAACAGCTCCAATGGAGATCTTGTAGACC
                      ____________________________________________________________
consensus ACGGTCGGATGGCCAGGCAAAGTTACAAACAGCTCCAATGGAGATCTTGTAGACC
 
. : . : . : . : . : . :
JMFF023M15+ TCTTTTTCATTAAACATGGGGATCTGAATGAGGACGGAAGGGAAAACAGAAGTGCCAATC
                      ____________________________________________________________
consensus TCTTTTTCATTAAACATGGGGATCTGAATGAGGACGGAAGGGAAAACAGAAGTGCCAATC
 
. : . : . : . : . : . :
JMFF023M15+ TCGTAATCCTCACGCATCGGCTCCCATTTGTACCTTTTCTCCGGCTTTCCGCAGAAAATC
                      ____________________________________________________________
consensus TCGTAATCCTCACGCATCGGCTCCCATTTGTACCTTTTCTCCGGCTTTCCGCAGAAAATC
 
. : . : . : . : . : . :
JMFF023M15+ TTGACCAGAATGATCACAATCCCCATATAAAGCCTCTCCACGAAAAGCATCAGAGACATA
                      ____________________________________________________________
consensus TTGACCAGAATGATCACAATCCCCATATAAAGCCTCTCCACGAAAAGCATCAGAGACATA
 
. : . : . : . : . : . :
JMFF023M15+ GCCAAGCACACATACACGGCCAGCCTGAGCGCCGGAACGATCAGCGGCGCCTTCACCAAA
JMFF001F01+ GAGCGCCGGAACGATCAGCGGCGCCTTCACCAAA
                      ____________________________________________________________
consensus GCCAAGCACACATACACGGCCAGCCTGAGCGCCGGAACGATCAGCGGCGCCTTCACCAAA
 
. : . : . : . : . : . :
JMFF023M15+ TCCCACATCAGCCTCATCTGCGCCGCCACGTCCCCTCCCGGCCCCCGGAGCTCCGGCATC
JMFF001F01+ TCCCACATCAGCCTCATCTGNGCCGCCACGTCCCCTCCCGGCCCCCGGAGCTCCGGCATC
                      ____________________________________________________________
consensus TCCCACATCAGCCTCATCTGCGCCGCCACGTCCCCTCCCGGCCCCCGGAGCTCCGGCATC
 
. : . : . : . : . : . :
JMFF023M15+ ATCAACTCAACCTCATTAATCGCCACCCCCGCCATTATTACTATTTTTAAAAACAATTTA
JMFF001F01+ ATCAACTCAACCTCATTAATCGCCACCCCCGCCATTATTACTATTTTTAAAAACAATTTA
                      ____________________________________________________________
consensus ATCAACTCAACCTCATTAATCGCCACCCCCGCCATTATTACTATTTTTAAAAACAATTTA
 
. : . : . : . : . : . :
JMFF023M15+ CTCCACCCAGCTACTCAGAAACAGAGCAATCGATTATTACTCTGTGCTTATTCCTAATTA
JMFF001F01+ CTCCACCCAGCTACTCAGAAACAGAGCAATCGATTATTACTCTGTGCTTATTCCTAATTA
                      ____________________________________________________________
consensus CTCCACCCAGCTACTCAGAAACAGAGCAATCGATTATTACTCTGTGCTTATTCCTAATTA
 
. : . : . : . : . : . :
JMFF023M15+ AAAACGCCAAGCAATACTGTCCCTTTGCTCAGGATACCGAGCAGTATTGTGGCATTGTGC
JMFF001F01+ AAAACGCCAAGCAATACTGTCCCTTTGCTCAGGATACCGAGCAGTATTGTGGCATTGTGC
                      ____________________________________________________________
consensus AAAACGCCAAGCAATACTGTCCCTTTGCTCAGGATACCGAGCAGTATTGTGGCATTGTGC