Previous Contig 000011:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001E05Sequence560000011 (7)gb:BT001076_16353310.009Arabidopsis thaliana At4g17230/dl4650c mRNA, complete cds.>gb:AF419570_1798432 A714010911 (3)gb:AK117483_18155162e-67Arabidopsis thaliana At5g48150 mRNA for putative SCARECROW gene regulator, compl
JMFF031N14Sequence590000011 (7)gb:BT001076_16353318e-05Arabidopsis thaliana At4g17230/dl4650c mRNA, complete cds.>gb:AF419570_1798432 A696010911 (3)gb:AE016959_10221863e-61Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC11
JMFF049I02Sequence617000011 (7)gb:BT001076_16353319e-05Arabidopsis thaliana At4g17230/dl4650c mRNA, complete cds.>gb:AF419570_1798432 A713010911 (3)gb:AY062210_15650056e-22Oryza sativa chitin-inducible gibberellin-responsive protein (GIGR2) mRNA, compl
JMFS061D01Sequence642000011 (7)gb:BT001076_16353312e-06Arabidopsis thaliana At4g17230/dl4650c mRNA, complete cds.>gb:AF419570_1798432 A
JMFS119B03Sequence626000011 (7)gb:BT001076_16353318e-06Arabidopsis thaliana At4g17230/dl4650c mRNA, complete cds.>gb:AF419570_1798432 A
JMFS160D11Sequence554000011 (7)gb:BT001076_16353310.003Arabidopsis thaliana At4g17230/dl4650c mRNA, complete cds.>gb:AF419570_1798432 A
JMFS167D09Sequence627000011 (7)gb:BT001076_16353312e-07Arabidopsis thaliana At4g17230/dl4650c mRNA, complete cds.>gb:AF419570_1798432 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS167D09+ CGCATCACTAAACGAGCAACTATAGTANTCGTCAA
                      ____________________________________________________________
consensus CGCATCACTAAACGAGCAACTATAGTANTCGTCAA
 
. : . : . : . : . : . :
JMFS167D09+ TTTCAGATTCGGGACCGAGCAATTTATTCTCCAATTCTCGCAACACATGCCTCAGTTCAT
JMFS119B03+ GATTCGGGACCGAGCAA-TTATTCTCCAATTCTCGCAACACATGCCTCAGTTCAT
JMFS061D01+ GATTCGGGACCGAGCAATTTATTCTCCAATTCTCGCAACACATGCCTCAGTTCAT
JMFF049I02+ GCAACACATGCCTCAGTTCAT
                      ____________________________________________________________
consensus TTTCAGATTCGGGACCGAGCAATTTATTCTCCAATTCTCGCAACACATGCCTCAGTTCAT
 
. : . : . : . : . : . :
JMFS167D09+ TCCCATCAACAACGCCAGAACACCCGCTTAAAGGCGAACCACAAGTAGTATTATCCGACA
JMFS119B03+ TCCCATCAACAACGCCAGAACACCCGCTTAAAGGCGAACCACAAGTAGTATTATCCGACA
JMFS061D01+ TCCCATCAACAACGCCAGAACACCCGCTTAAAGGCGAACCACAAGTAGTATTATCCGACA
JMFF049I02+ TCCCATCAACAACGCCAGAACACCCGCTTAAAGGCGAACCACAAGTAGTATTATCCGACA
JMFS160D11+ TAAAGGCGAACCACAAGTAGTATTATCCGACA
JMFF031N14+ CAACAACGCCAGAACACCCGCTTAAAGGCGAACCACAAGTAGTATTATCCGACA
JMFF001E05+ ACAAGTAGTATTATCCGACA
                      ____________________________________________________________
consensus TCCCATCAACAACGCCAGAACACCCGCTTAAAGGCGAACCACAAGTAGTATTATCCGACA
 
. : . : . : . : . : . :
JMFS167D09+ TATACGACTGAGAGCATTGGGGAGAAAACGCGCTCCGATTGGAAGAAACACTGGCAGCAG
JMFS119B03+ TATACGACTGAGAGCATTGGGGAGAAAACGCGCTCCGATTGGAAGAAACACTGGCAGCAG
JMFS061D01+ TATACGACTGAGAGCATTGGGGAGAAAACGCGCTCCGATTGGAAGAAACACTGGCAGCAG
JMFF049I02+ TATACGACTGAGAGCATTGGGGAGAAAACGCGCTCCGATTGGAAGAAACACTGGCAGCAG
JMFS160D11+ TATACGACTGAGAGCATTGGGGAGAAAACGCGCTCCGATTGGAAGAAACACTGGCAGCAG
JMFF031N14+ TATACGACTGAGAGCATTGGGGAGAAAACGCGCTCCGATTGGAAGAAACACTGGCAGCAG
JMFF001E05+ TATACGACTGAGAGCATTGGGGAGAAAACGCGCTCCGATTGGAAGAAACACTGGCAGCAG
                      ____________________________________________________________
consensus TATACGACTGAGAGCATTGGGGAGAAAACGCGCTCCGATTGGAAGAAACACTGGCAGCAG
 
. : . : . : . : . : . :
JMFS167D09+ GGGGCGAATCATAATACACGGAATCAATTCCAGCAGGCGCTGAATCCAAAGTGAAGAACT
JMFS119B03+ GGGGCGAATCATAATACACGGAATCAATTCCAGCAGGCGCTGAATCCAAAGTGAAGAACT
JMFS061D01+ GGGGCGAATCATAATACACGGAATCAATTCCAGCAGGCGCTGAATCCAAAGTGAAGAACT
JMFF049I02+ GGGGCGAATCATAATACACGGAATCAATTCCAGCAGGCGCTGAATCCAAAGTGAAGAACT
JMFS160D11+ GGGGCGAATCATAATACACGGAATCAATTCCAGCAGGCGCTGAATCCAAAGTGAAGAACT
JMFF031N14+ GGGGCGAATCATAATACACGGAATCAATTCCAGCAGGCGCTGAATCCAAAGTGAAGAACT
JMFF001E05+ GGGGCGAATCATAATACACGGAATCAATTCCAGCAGGCGCTGAATCCAAAGTGAAGAACT
                      ____________________________________________________________
consensus GGGGCGAATCATAATACACGGAATCAATTCCAGCAGGCGCTGAATCCAAAGTGAAGAACT
 
. : . : . : . : . : . :
JMFS167D09+ GCTCGTTTTGGGCCTGGAAAAAGCCTTGTTCCCCTACACTACCACTCTCATTCGAAACAT
JMFS119B03+ GCTCGTTTTGGGCCTGGAAAAAGCCTTGTTCCCCTACACTACCACTCTCATTCGAAACAT
JMFS061D01+ GCTCGTTTTGGGCCTGGAAAAAGCCTTGTTCCCCTACACTACCACTCTCATTCGAAACAT
JMFF049I02+ GCTCGTTTTGGGCCTGGAAAAAGCCTTGTTCCCCTACACTACCACTCTCATTCGAAACAT
JMFS160D11+ GCTCGTTTTGGGCCTGGAAAAAGCCTTGTTCCCCTACACTACCACTCTCATTCGAAACAT
JMFF031N14+ GCTCGTTTTGGGCCTGGAAAAAGCCTTGTTCCCCTACACTACCACTCTCATTCGAAACAT
JMFF001E05+ GCTCGTTTTGGGCCTGGAAAAAGCCTTGTTCCCCTACACTACCACTCTCATTCGAAACAT
                      ____________________________________________________________
consensus GCTCGTTTTGGGCCTGGAAAAAGCCTTGTTCCCCTACACTACCACTCTCATTCGAAACAT
 
. : . : . : . : . : . :
JMFS167D09+ CGTTGTTCAAAACATGGAAAGCGGCATAATACTGCTGAGGCTGATGGTAAAACCTCTGTA
JMFS119B03+ CGTTGTTCAAAACATGGAAAGCGGCATAATACTGCTGAGGCTGATGGTAAAACCTCTGTA
JMFS061D01+ CGTTGTTCAAAACATGGAAAGCGGCATAATACTGCTGAGGCTGATGGTAAAACCTCTGTA
JMFF049I02+ CGTTGTTCAAAACATGGAAAGCGGCATAATACTGCTGAGGCTGATGGTAAAACCTCTGTA
JMFS160D11+ CGTTGTTCAAAACATGGAAAGCGGCATAATACTGCTGAGGCTGATGGTAAAACCTCTGTA
JMFF031N14+ CGTTGTTCAAAACATGGAAAGCGGCATAATACTGCTGAGGCTGATGGTAAAACCTCTGTA
JMFF001E05+ CGTTGTTCAAAACATGGAAAGCGGCATAATACTGCTGAGGCTGATGGTAAAACCTCTGTA
                      ____________________________________________________________
consensus CGTTGTTCAAAACATGGAAAGCGGCATAATACTGCTGAGGCTGATGGTAAAACCTCTGTA
 
. : . : . : . : . : . :
JMFS167D09+ CACTGCTAGACGACGATTGAGGTCCCTGGGAGGCCTGCATTTGTAGTTGCGGAATAACCC
JMFS119B03+ CACTGCTAGACGACGATTGAGGTCCCTGGGAGGCCTGCATTTGTAGTTGCGGAATAACCC
JMFS061D01+ CACTGCTAGACGACGATTGAGGTCCCTGGGAGGCCTGCATTTGTAGTTGCGGAATAACCC
JMFF049I02+ CACTGCTAGACGACGATTGAGGTCCCTGGGAGGCCTGCATTTGTAGTTGCGGAATAACCC
JMFS160D11+ CACTGCTAGACGACGATTGAGGTCCCTGGGAGGCCTGCATTTGTAGTTGCGGAATAACCC
JMFF031N14+ CACTGCTAGACGACGATTGAGGTCCCTGGGAGGCCTGCATTTGTAGTTGCGGAATAACCC
JMFF001E05+ CACTGCTAGACGACGATTGAGGTCCCTGGGAGGCCTGCATTTGTAGTTGCGGAATAACCC
                      ____________________________________________________________
consensus CACTGCTAGACGACGATTGAGGTCCCTGGGAGGCCTGCATTTGTAGTTGCGGAATAACCC
 
. : . : . : . : . : . :
JMFS167D09+ TTCTTCACTCGCTCAAAAATGGGTGAATACTACTTCACTTCAGGTACGTTTCTTCGATCG
JMFS119B03+ TTCTTCACTCGCTCAAAAATGGGTGAATACTACTTCACTTCAGGTACGTTTCTTCGATCG
JMFS061D01+ TTCTTCACTCGCTCAAAAATGGGTGAATACTACTTCACTTCAGGTACGTTTCTTCGATCG
JMFF049I02+ TTCTTCACTCGCTCAAAAATGGGTGAATACTACTTCACTTCAGGTACGTTTCTTCGATCG
JMFS160D11+ TTCTTCACTCGCTCAAAAATGGGTGAATACTACTTCACTTCAGGTACGTTTCTTCGATCG
JMFF031N14+ TTCTTCACTCGCTCAAAAATGGGTGAATACTACTTCACTTCAGGTACGTTTCTTCGATCG
JMFF001E05+ TTCTTCACTCGCTCAAAAATGGGTGAATACTACTTCACTTCAGGTACGTTTCTTCGATCG
                      ____________________________________________________________
consensus TTCTTCACTCGCTCAAAAATGGGTGAATACTACTTCACTTCAGGTACGTTTCTTCGATCG
 
. : . : . : . : . : . :
JMFS167D09+ AAACGAGTCCATTGATCACAAAAGGGAGTGTAACCAACAAAATCTGAACAAGTACTTCTC
JMFS119B03+ AAACGAGTCCATTGATCACAAAAGGGAGTGTAACCAACAAAATCTGAACAAGTACTTCTC
JMFS061D01+ AAACGAGTCCATTGATCACAAAAGGGAGTGTAACCAACAAAATCTGAACAAGTACTTCTC
JMFF049I02+ AAACGAGTCCATTGATCACAAAAGGGAGTGTAACCAACAAAATCTGAACAAGTACTTCTC
JMFS160D11+ AAACGAGTCCATTGATCACAAAAGGGAGTGTAACCAACAAAATCTGAACAAGTACTTCTC
JMFF031N14+ AAACGAGTCCATTGATCACAAAAGGGAGTGTAACCAACAAAATCTGAACAAGTACTTCTC
JMFF001E05+ AAACGAGTCCATTGATCACAAAAGGGAGTGTAACCAACAAAATCTGAACAAGTACTTCTC
                      ____________________________________________________________
consensus AAACGAGTCCATTGATCACAAAAGGGAGTGTAACCAACAAAATCTGAACAAGTACTTCTC
 
. : . : . : . : . : . :
JMFS167D09+ TGATGAATTTAAGTTTTCAGGATTTTTCTTTTCCTTCCGAGGGGAGAGACGA
JMFS119B03+ TGATGAATTTAAGTTTTCAGGATTTTTCTTTTCCTTCCGAGGGGAGAGACGATTGGTGGT
JMFS061D01+ TGATGAATTTAAGTTTTCAGGATTTTTCTTTTCCTTCCGAGGGGAGAGACGATTGGTGGT
JMFF049I02+ TGATGAATTTAAGTTTTCAGGATTTTTCTTTTCCTTCCGAGGGGAGAGACGATTGGTGGT
JMFS160D11+ TGATGAATTTAAGTTTTCAGGATTTTTCTTTTCCTTCCGAGGGGAGAGACGATTGGTGGT
JMFF031N14+ TGATGAATTTAAGTTTTCAGGATTTTTCTTTTCCTTCCGAGGGGAGAGACGATTGGTGGT
JMFF001E05+ TGATGAATTTAAGTTTTCAGGATTTTTCTTTTCCTTCCGAGGGGAGAGACGATTGGTGGT
                      ____________________________________________________________
consensus TGATGAATTTAAGTTTTCAGGATTTTTCTTTTCCTTCCGAGGGGAGAGACGATTGGTGGT
 
. : . : . : . : . : . :
JMFS119B03+ CCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTG
JMFS061D01+ CCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGTCTTCTGCAACAAG
JMFF049I02+ CCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGTCTTCTGCAACAAGCCGATTGCTT
JMFS160D11+ CCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGTCTTCTGCAA
JMFF031N14+ CCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGTCTTCTGCAACAAGCCGATTGCTT
JMFF001E05+ CCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGTCTTCTGCAACAAGCCGATTGCTTAAAC
                      ____________________________________________________________
consensus CCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGTCTTCTGCAACAAGCCGATTGCTTAAAC