>rJMCP020H08 358 bp,
GTGTAATTTTAATTGGTTCACTTCCAACAAAAAGAACGTGACAACGTATAATAACTAGCC
AGGTAAAGAGAATCCAAGACATCTGTTTAGGAAAAAGAACTCACACTTGTTTCACTAGCA
TTCAAAATAATCATATTGCACAAACATATCaTATAGTTATCAGCACCTAAAGCAAATTTA
TTGGTGAGGGATGTGCACAATTGCTTGCATTAAAATCCTTTTCAGCTGATCAATGCATAA
AATAAATGCTATAACTAGTCCGACTAGGATTATGATAAAGAAAAAATCTGACTAATATGA
AAGAAAAAAAATA