>JMCP020H05 313 bp,:Filtered
GGGGCTTGTTTTTGTATAGTGGATAATATATCCAGATGAGAATTGCTTTATATATATATA
TTTATTTATTTAGAGAGAGAAACAGATAGTATATGTAGAGAGAGAGAAGCTATGCATGCA
AAACAGAGAAGAGAGAAGGAGTTGAAGAGAGAGAGAGAAGGAGAGGGATCGAGACCGAGA
GAAAGAGAAGGAGAGGGAACGTGAAAGAGAAAAGGAGAGAGAGAAAGAAAAGGAGAGGGA
TAAGGAAAGGGAGAGAAGAGAGAGAGATAGGAGGC