>JMCP020G08 224 bp,:Filtered
TGGGTTTGAGCGAAGTTAGTCAACATACCATGGTTGATAAATTCTTGCAGCACAAGTGGC
GGTTCAAGTATCTGAAGGGAAAGTTCGTCATAGGCCAGTGATAACTCGTGTGATTTTGCA
ACCAACGGCTTTGCAACTGAAAGACAGAACAGTTGGTGTAAGAAATAATGTATTGTCACA
CACCGACATAATAATGCG