>rJMCP020G03 262 bp,
GTGAAAGCTAAGGTGGAGATCGAGTATTACTAGCTAGAATCGCCGCTTTCACGCTAGttt
tgtgaatacccctcctacactaTACTAcaaggcCAAGATCACACTTTTCCGTTTATTGTA
ATAGGCCAATAGTCCACGTTGCAAGAGATCTCCAAACCAGGAATACACTTGTCTATACAT
TCATGCAAGATACGGGTATATTCTGCCTATACATATA