>JMCP020F02 266 bp,:Filtered
AACGCAGAGTGTCTAGCTGCCGGTTATTATAAGGTCCAGTTTGTTTCAAGAGATGCCACT
GCAAGCATTATGTTCTAGATGGAGATATCTAAGCATCCTGATAGTCTACCTGATTTCATG
AACTAGAACATTATGATCTTCCACATTTGTAACATGTACTATATTTGATTAGAGTCATCA
GCTATTGCGCTAACTCAAAAAGTGTATAAAGTAGAGAATATTTTAGAACACCTGACTGTT
AGCTAAGAATTTGTGTCTGGGGTGTC