>JMCP020F01 314 bp,:Filtered
AAGGAAAGTGCGAGGAAGGGTATGATTTGAACTCTACCAATTGTAACAGGTAATAAGCGA
GAAGACAAGCTAGTTTCATGTCCAAGGTTCAGTGTATTTGAGTAGCTTAGCTAGCAACTT
ATATAAATCTTTGTTGGGACTCTTATTAGGAAATTAATTGGGGCTAGATTTTACTACGAT
GCCTTGGAGTGCCATTTTTGTCAACAAGGGACACGTTAGGCCATGGAAGTCATGTTGTGT
CAACGACGGCTATTTCAGTAATTAAAATcgTGTCATACTATCGTTT