>JMCP020E10 427 bp,
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTC
AACAACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAAC
TACCAGAATATGGAGGAGTTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATT
TTTTTTTTCTacaaaGTTAaaaGATGATCATGTGACggagtccCaaAATCTGCA