>JMCP020C10 391 bp,
ATTCAGGATCTTGGTCCTCTTGCTTCTCTTGTCTTTGGGTTCTGATTTTTATTTTGGAAA
AGTAGCGAATCTAATCGTAGTGACGATTCAGTCCATGCATTATTACCGCATCTATTGATT
CAGTTCATGCGTTATTAGCGTATCTatTTTTAGTCCTTAAGAAGTGGCGAGTTTGGTTCC
TGACGCTAGTGTTGTGTTGATAAAATTAATTACAAGGGTAAAGAAACAAATTTTTTAATA
AAACTTGTAAATTTATCCAAAATACTCTCCCCAAATCAACAAAAGCCATAAGTTACTTAA
CAACGAATAAATCATACTCTCGTTTTTCTaaAAGATCAAATTTCAATATTTCAATTATAT
TTTTT