>rJMCP020B12 275 bp,
ATGGGGGACGCTCAGCAAAGCTTGAAACTCTGTTCGACCCTGAGCCTGGGCTTTCGGTTG
TTTTCTCAGCAAAACGAACTTTGTCATCCAAGTCACGGATCAGCAATTCCAATTCCCTTT
CTTTTTGATTTATCAAATCATGGGTGGCTGCCTGATCTTCACCAGCATCTTGAAGTGCTT
CTTTCTTGAGCTGTTCTATTTCTTTTTTCAAATTCTTTTCCTCATCTGTC