>JMCP020B09 282 bp,:Filtered
TTGAAAGAAAAACCATATTGGATCATCAagaACTcGTGGGGCGAGAGCTGGGGAGAGAAG
GGATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTact
gTTGCAGCTGTTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAG
TTCTGTAAGATATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAACATACT
ATGCAAGTGTATTCATTATTAGATTTCATCAATCTATTTCTC