>rJMCP020B07 236 bp,
AGGGCGACTTCGACTACCTTCTGTGTTCTTAAAATCTGGTGCTTTTGCTTTCAAACTTGG
CTTTTCATCTGTTACTTTAAGGAGGTCATCAGACAAGAGATCTAAATCATCCCAAGAAGG
TATAGGGAAACTTGACAAGTAACTTTCATCCATTGTCTGATCTTCATTGAAGCCCCCGAC
gccatcCCCCGAACA