>JMCP020B04 454 bp,:Filtered
GTTGGTAAAGGAGTCGGAGGAAAAAGCAAATCAACAGTGGGAGTGTGAGCTGTTCCAGGT
AGTGGTGTCTGAGCTGTTCCAGGCATAGGTGTTGGGGCTGGGGTGGGTAAAGGAGTCGGA
GGAAACAGTAAATCAGCAGTGGGAGTTTCGTACTCCTCACTGCCTTCGTAGGGTACATTA
AGGTCATGCACAGGGGTGATTGGACCGCCGGGTACCACTTTCGGAGCGGTGTTCCTCTCA
ATCGGACCCAATATAGCCCCAGCTTGCATCATTTTCATCTCCCATATCTAAAAAATCCAC
ATAAACTTATCAACTAAAATCTCCGAAAATTAACCCCACACTCCGATAGATCTACACAAA
ACGTATTAGCCCTAGaagggttcAGATCGATCcacaAcccagtAACAGaaTCAAATTCCC
ACATTACA