>JMCP020A08 210 bp,:Filtered
GCACTACGTCAACTCTCCGAATGCTAGAAAGGTCGCTAGCTCTTGCGGCGTCTCTATCCC
CTCCAGTTAATTATAGTTCTATATATACCAATACTGTACTGTGTAGTGCATACGGTACAG
AGAATAATATGAAATAATATGCCTTGTTTGGCTCTTTTGATCATTGAATAAAGAGTGATG
AGCTCGTTTCGTG