>JMCP019H04 556 bp,
CTCTCAGCTCCGGATTTCAGTTTGATCGCCGAACTGAGAATTCCACCGCCGGCGGCCCAA
AATGGTGCACGTCAACTTTTACCGGAACTATGGGAAGACATTTAAGAAGCCTCGTAGGCC
ATATGAGAAAGAGCGATTGGATGCTGAGTTGAAGCTTGTTGGTGAGTATGGACTTAGGTG
CAAGAGGGAACTCTGGAGGGTTCAGTATGCATTGAGCCGTATCAGGAATAACGCAAGAAT
GCTTCTCACACTCGATGAGAAGGACCCAAGGCGTATTTTTGAGGGTGATGCCCTTTTGAG
AAGGATGAACAGGTATGGCTTGCTTGATGAGAGTCAGAACAAGCTTGATTATGTCCTTGC
CCTAACTGTGGAGAACTTCCTTGAGCGCCGTCTCCAAACTCTTGTGTTCaagGCTGGCAT
GGCAAAGTCAATCCATCATGCTAGGGTGCTCATTAGgCAAAAGCACATcagggtTGgaag
gcAggTTGTGAACGTCCCCTCCTTCttggtcAGAgtggactcgCagaagcacATTGATT