>JMCP019H03 414 bp,:Filtered
TCAACGCAGAGTTCATGCAGACTTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCA
AGAGGCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCC
GGTTGAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGA
AGGGATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTA
CTGTTGCAGCTGTTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGT
AGTTCTGTAAGATATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAACATA
CTATGCAAGTGTATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCATCG