>JMCP019F05 607 bp,
TGAAAAGGGGCAAAAAGTTCTAACAGCAAGCAGCCCATAGTTACAACCACCTTGTTTTTC
GCAAATGTAATAAATTATGGCTTTCCATTGTAAGCTATTGAATATGCTAAATGAGAGCCA
ATTTAGGGAGAAGAAGATAAATTCCCAGGTACAAACTAACACAGTATCTTGTACACTCTA
AGCATAGATGGCCTAGTTGTCATTCATGGAAATCTAGGAACTCAAACTAATACTCCGTAT
TAAGATAACGTGACAATCTCTTTCCTAAATCAGATTAAGTAGTAAAGATACATGACGCAG
TATACTTCATTGAGCTTCAGTGTACAAAATAACATCAGACAAACTAAAGTTTCTTAAATA
TATTCATAACAGTGGAAGGCTTTAGTCAAAACCGAGATCATATAACGAAATTAATGACAT
GTTCACTACAAGATTCATATGCATGCAAATGCACCTTTTTcacCTTTTCTTCAAAGCAGT
TAACTAAAAATTgttAATTTTGTTTTACAGTcagcatattACATGGTagcacagggTAAA
ACaaagatcTTACCTGGAAAGC