>JMCP019A11 452 bp,
AGGTCTAGAAACATCATATCTAATAAAAAACATGGTAGTAGATGGATCATGGAGTAGCCA
AGGCCACCATTCCATTTTAATTTGAAAGAAACAATCTTTTTGGTAGAACAGTACAGTTGT
ACCTTCTGATTGTTAAAATTGGTCATAATTATCATAGGCCAATTAAGTCAAGACTCAAGC
GGAGCAATAATGTTTAATTTGTTGATATCATGAACATTAGCATTGTGTGAATTGATCAAC
TTCTATATATGATCTATCTCATCTAAATAATCATGTTAAGATGATCTGAACATCTAACCA
GTAGTACTATCAGATAGATGCATTAAAACTTCAAAACTTAAATTTAATTTGTATCATTAA
AAGAGTCCCTAAAATTACCTCCTCCGTTCcaaATATTAGCTTCGCTGCTTGACAGTGAAT
GG