>JMCP019A01 538 bp,
TGAAAAGGGGCAAAAAGTTCTAACAGCAAGCAGCCCATAGTTACAACCACCTTGTTTTTC
GCAAATGTAATAAATTATGGCTTTCCATTGTAAGCTATTGAATATGCTAAATGAGAGCCA
ATTTAGGGAGAAGAAGATAAATTCCCAGGTACAAACTAACACAGTATCTTGTACACTCTA
AGCATAGATGGCCTAGTTGTCATTCATGGAAATCTAGGAACTCAAACTAATACTCCGTAT
TAAGATAACGTGACAATCTCTTTCCTAAATCAGATTAAGTAGTAAAGATACATGACGCAG
TATACTTCATTGAGCTTCAGTGTACAAAATAACATCAGACAAACTAAAGTTTCTTAAATA
TATTCATAACAGTGGAAGgCTTTAGTcaaAACCGAGATCATATAACGAAATTAATGACAT
GTTCACTAcaaGattCaTATGCATGCAAATGCACCTTTTTcacCTTTTcttcaaagCAgt
taACTAAAAATTGTTAATTTTGTTTTACAG