>JMCP018G12 408 bp,:Filtered
GGAACTACTTTGATTGATATAGAGTCCACTTGGGCGGAGTTGGCTAGCTATGTTGATATC
TCTGTTCGTCCGCCGTGGATTCTAGATGATGTTGTGACCAGACTCCGGTTTCTGTGTTCC
TGTGGGGTGGTTACTGCTTCTGTGTGCCCGTCCAGGGCCAATATGCCTGCACAGGCGCTA
GCTAACTGGGCGGTGGATAAGCCGGGGGAGGCCATCTTTCGGAGCCTCAATGATCTGCCA
CGTAGGGTCCGTGCTTTACTGATACATGATGATGTGCCCTATGTGTTTTTTGATATTGAT
GATCCCCCGTGATTGTACTTGTACTTTGTTTGATTAGTTGGAAATTTGGAAATAAGAAAA
AGC