>JMCP018G11 620 bp,:Filtered
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTC
AACAACGATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAAC
TACCAGAATATGGAGGAGTTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATT
TTTTTTTTTTCTACAAAGTTAAAagaTGATCATGTGACGGagtCCCAAAATCTGCAAATT
AAGcACAcgaCTGGGTGTTTGATTGTGTGTTAAATTATGGTTGTTTAGGGGTGAATATGT
TGATGATGATTAAGCTATagaTTTGTTCATAGGTTATTAATTATCTCCTGTCTCTATAGT
TATATTgtgTGTGAATGagaCCATGAAACTATGGTTTTGTGTCAAAGT