>JMCP018G04 621 bp,:Filtered
GTGTCCTGGCAGGGGAAAATGGACCTGGCGTGGATGGACTGACATTGGGTGTAAACAAAC
GGGTGGGTTTTGTTAAAAGTTTGCGGCGGCGAAAGCCACTGGAGAGCTGAGCTAGAGGGG
CTCGTTTTCGAGAGCACCAACACCTGAGCTTGGCCCGAAAGTGAGACGGTGACTGATTGC
CCGATCACTGGGTCCGGCAGGGACGGAGAAAGGGAGAAGGGGAGCGGCGAAAGTGAAACT
GGGTCGAGAACGGCGGAGATGGAGAGGGAACGGGTGTCAAGAGTGAGGTCGCCGGAATAA
GGGGCGGCGAGGGAGAGGAGAGTCGCAGCAGAGATAGTTGAGGACGGGAAATCAAAGTAG
AGAGTAAGGGAGATATGGACAGTGAAGGGATGAGCAGAGTCCGTGAAAGAATGGGGATCA
ACGGGCGCCATGACTTCGGTTTTGCAAGGACTTCTATACAAAACTGGATTTTTGGAGTAG
CGAAGAAGACGATTGCTTTTTTCTAAAATTTACCGTCTTGGAGGGTCAAGACCGCagatg
CATAAATATATGAGATTTGAGAATAATTGACACTTCCAC