>JMCP018G03 660 bp,
AATGTAGTGATCGACGGCGGAAGAAGCTCCTCCGCCGCCACCGGCGGCGTTATGGCTCCC
TCCGCCGCCAGTGCTGACGTAGCGGAGCTCCGTTTTTCCTTGAACCCTTTCCGGGAAATT
GAGCTTGGCTTTGGAACCCTTGAACTTAAGAGCAGCTTCATCGTATGCAAGAGCTGCATC
CTCAGCTGTGTCGAATGTTCCCAGCCAAACTCCAGCCGCTTTTTTCGGGTCACGAATCTC
CGCCGCCCATTTGCCCCACGGCCTCTGCCTTACGCCTCTATAATGTCGTCTCACGTTTCC
TTTATCAAAGCACAAAATTCAAAAAAAAAAAGTCCTAATAagaCGTAAtTGAagaatgtg
TTctgTTTCACCTCTCATCTCgtaatgATACCAAAttagaaaatgCTTCataCATagtAA
TTCAatgTCACTaGCAatCCTCTTTagcTATAagtcggatgGGGAACAAATAAatgTATC
aatTTCTACTACTAACtTGTTGCTATAAatgTACTTTTCCAagaAATTCTTAACTTATCT
tagtTCACtTGATCAAagaTATATATAATAATTAATTCAAAATATTCTCATATTCTCTTA
AAAGTAAAGTAAATGA