>JMCP018G01 619 bp,
GGCTGATGGTAAAAGAACCGTTCTTGTTACCGGAGCTGGTGGCAGAACCGGGCAAATTGT
GTATAAGAAGTTGAGGGAGAATTCAGACAAGTATATTACAAGAGGTTTGGTGAGAAGTGA
GGAGAGCAAGGCGAGAATTGGTGGCGCAGATGATATTTACATTGGTGATATAAGGAATGC
TGAGAGCATAGTTCCTGCAATTCAGGGTATCGATGCTATTATAATTCTTACAAGTGCTGT
GCCAAGGATGAAACCAGGTTTCGATCCATCTAAAGGTGAAAGGCCAGAGTTCTACTTTGA
AGATGGATTATCCCCTGAACAAGTGGACTGGATTGGGCAGAAGAATCAAATAGATACTGC
TAAGGCCGCAGGAGTAAAGCATATTGTGCTGGTTGGGTCAATGGGAGGAACAAATCCTAA
CCACCCCCTGAACACCTTAGGAAATGGAAACATATTGATTTGGAAGAGGAAGTCTGAAGA
GTATTTAGCGGACTCTGGAGTCCCATATACCATTATTAGAGCCGGGGGCTTGCAAGAtaA
GAATGGTGGTGAGCGGGAGCTACTTGTTGGAAAGgacgaTGaaCTTCTTCAGACAGAGAA
T